Computational protocol: REV3L, a Promising Target in Regulating the Chemosensitivity of Cervical Cancer Cells

Similar protocols

Protocol publication

[…] All of the primers used in the study were designed using Primer Premier 5 software. To test for possible repetitive sequences, primers were aligned with the GeneBank database using the BLAST online tool. AutoDimer Software was used in the detection of potential hairpin structures and possible primer-dimer combinations. All primers were synthesized by Sangon Biotech Co., Ltd. (Shanghai, China). Three short hairpin interfering RNA (shRNA) targeting REV3L were designed and chemically synthesized and inserted in pBABE/U6/Puro vector according to the previously reported method[,]. We selected one shRNA with a highest inhibition efficiency using the cell lines with high expression of REV3L (Forward primer: 5'-GGAGAATAGAACTATGG TGCAAGCCTACGTAGCGTCTGCACCATAGTTCTATTCT CCCTTTTTG-3'; Reverse primer: 5'-AATTCAAA AAGGGAGAATAGAACTATGGTG CAGACGCTACGTAGGCTTGCACCATAG TTCTATTCTCC-3'). The pBABE/U6/Puro vector containing negative control (NC) shRNA (shGFP) was similarly constructed by directly inserting oligo nucleotides encoding small hairpin RNA against green fluorescence protein mRNA (shGFP) into pBabe/U6/puromycin[,]. Retroviruses expressing REV3L shRNA or GFP shRNA were produced by transfection of pBabe/U6/shREV3L or pBabe/U6/shGFP into phoenix amphotropic cells and used to infect target cells by using a method described before[]. In short, cells were infected with virus supernatants, and after a 24-hour recovery, the cells were selected with puromycin (200 ng/mL) for 10–14 days to establish stable cell lines expressing shREV3L or shGFP. The resulting cells were grown in the medium without puromycin and used for further experiments. Cell lines with low expression of REV3L were transfected with the pcDNA3.1/neo-REV3L plasmid (provided by Dr. Yoshiki Murakumo, Nagoya University Graduate School of Medicine, Nagoya, Japan) or the pcDNA3.1/neo negative control plasmid using Lipofectamine 2000 per the manufacturer’s instructions. After 48 h and within 120 h of transfection, cells were used for further analysis. […]

Pipeline specifications

Software tools Primer Premier, AutoDimer
Application qPCR
Organisms Homo sapiens
Diseases Leukemia, Myeloid, Neoplasms, Lymphoma, B-Cell
Chemicals Cisplatin