Computational protocol: KAP1 Regulates Regulatory T Cell Function and Proliferation in Both Foxp3-Dependent and -Independent Manners

Similar protocols

Protocol publication

[…] Total RNA was purified with the NucleoSpin RNA Kit (Clontech). RNA-seq libraries were prepared using the TruSeq RNA Library Prep Kit v2 (Illumina) and sequenced using an Illumina HiSeq 2500. Sequences were mapped to mm10 with TopHat2 (v2.1.1). Tag counts were obtained with HTSeq (v0.7.2), and further analysis was performed using the R package (DESeq2). An adjusted p value <0.05 was considered significant. [...] Fresh isolated Tregs (for H3K9me3) and expanded Tregs (for KAP1) were used for ChIP-seq. Cells were cross-linked with 1% formaldehyde for 10 min at room temperature and lysed. Nuclei were collected and sonicated using a Covaris M220 (Covaris). Lysates were incubated with anti-H3K9me3 antibody (ab8898, abcam), anti-KAP1 antibody (1Tb-1A9, Active Motif), or control IgG at 4°C overnight. Protein G beads (Cell Signaling Technology) were added to the lysates and incubated for 2 hr at 4°C. Beads were washed, and antibody/protein/DNA complexes were eluted. Samples were incubated at 65°C overnight to reverse cross-linking, and chromatin was recovered using a PCR purification kit (QIAGEN). ChIP-seq libraries were prepared by using the DNA SMART ChIP-Seq Kit (Clontech), and the libraries were subjected to sequence analysis with an Illumina HiSeq 2500. The obtained sequences (50 bp) were mapped to mm10 using Bowtie 2 (v2.2.9), and uniquely mapped reads were selected. Duplicated reads were discarded using Picard Tools (v2.1.1). For , we counted reads that were aligned between −1 kb and +1 kb of the TSSs using the ‘intersect’ tool in the bedtools software (v2.26.0). MSCS2 (v2.2.1) was used for the peak calling. For further analyses and visualization, ngsplot (v2.41), ChIPpeakAnno (v3.5), Homer (v4.9), and Integrative Genome Viewer (v2.3.91) were used. Sequences of qPCR primers for ChIP-qPCR are as follows: Prdm1 forward (fwd): CCAGTAGGCCTTT CATGGCT, Prdm1 reverse (rev): TGCTAGTTTCTTGGGGTGCG; Slc1a5 fwd: CCCCTTCTTAAGCCACCAAGA, Slc1a5 rev: AGATGCTGTCATGGGAGGGT. […]

Pipeline specifications

Software tools Bowtie, Picard, BEDTools, ChIPpeakAnno
Application ChIP-seq analysis
Organisms Homo sapiens, Mus musculus
Diseases Autoimmune Diseases