EFTUD2 statistics

Tool stats & trends

Looking to identify usage trends or leading experts?

Protocols

EFTUD2 specifications

Information


Unique identifier OMICS_23939
Name EFTUD2
Alternative name Elongation Factor Tu GTP binding domain containing 2
Restrictions to use None
Community driven No
Data access Browse
User data submission Allowed
Maintained Yes

Maintainer


  • person_outline Dennis Bulman

Publication for Elongation Factor Tu GTP binding domain containing 2

EFTUD2 citations

 (6)
library_books

R2TP/Prefoldin like component RUVBL1/RUVBL2 directly interacts with ZNHIT2 to regulate assembly of U5 small nuclear ribonucleoprotein

2017
Nat Commun
PMCID: 5460035
PMID: 28561026
DOI: 10.1038/ncomms15615

[…] a: 6; (8) Maximum missed cleavages: 2; (9) Maximum of labelled amino acids: 3; (10). Proteins were considered quantified if they had at least one quantified SILAC pairs. Interactors of immunopurified EFTUD2-FLAG and PRPF8-FLAG were identified based on a Log2(M/L)>1. Interactions were then considered as significantly affected only when the Log2(M/H) ratio was greater than 1 or lower than −1 (twofol […]

library_books

Intron retention is regulated by altered MeCP2 mediated splicing factor recruitment

2017
Nat Commun
PMCID: 5424149
PMID: 28480880
DOI: 10.1038/ncomms15134

[…] etic factors and associated proteins. Indeed, H3.3K36me3 mediated recruitment of BS69 is known to promote IR by antagonizing the activity of the spliceosome via its interaction with snRNPs, including EFTUD2 (ref. ). While BS69 has also been shown to repress RNA Pol II elongation, this work was performed in U20S cells rather than HeLa cells where the IR-promoting role of BS69 was reported. Thus, th […]

library_books

HER2 genomic amplification in circulating tumor DNA from patients with cetuximab resistant colorectal cancer

2015
Oncotarget
PMCID: 4823119
PMID: 26657506
DOI: 10.18632/oncotarget.6498

[…] using the QX100 Droplet Digital PCR System in accordance with the manufacturer's instructions (Bio-Rad, Hercules, CA, USA). The relative HER2 copy number ratio was calculated relative to the control EFTUD2 gene, as previously described []. For HER2 copy number assays, the primer sequences were as follows: HER2 forward, 5′-ACAACCAAGTGAGGCAGGTC-3′; HER2 reverse, 5′-GTATTGTTCAGCGGGTCTCC-3′; HER2 pro […]

library_books

Droplet digital PCR measurement of HER2 in patients with gastric cancer

2015
Br J Cancer
PMCID: 4430718
PMID: 25897674
DOI: 10.1038/bjc.2015.129

[…] 0-μl reaction volumes that consisted of up to 10 ng of extracted DNA (5 μl), 2 × ddPCR supermix for probe (10 μl), HER2 forward primer (0.2 μl), HER2 reverse primer (0.2 μl), HER2 FAM probe (0.5 μl), EFTUD2 forward primer (0.2 μl), EFTUD2 reverse primer (0.2 μl), EFTUD2 VIC probe (0.5 μl), and deionised distilled water (3.2 μl). The emulsified PCR reactions were run in a 96-well plate on a C1000 T […]

library_books

Determination of HER2 Amplification Status on Tumour DNA by Digital PCR

2013
PLoS One
PMCID: 3873285
PMID: 24386193
DOI: 10.1371/journal.pone.0083409

[…] CR system (Bio-Rad) with HER2 primers (HER2F: ACAACCAAGTGAGGCAGGTC, HER2R: GTATTGTTCAGCGGGTCTCC, HER2 MGB probe: FAM-CCCAGCTCTTTGAGGACAAC) at a final concentration of 900 nM primers and 250 nM probe, EFTUD2 primers (EFTUD2F: GGTCTTGCCAGACACCAAAG, EFTUD2R: TGAGAGGACACACGCAAAAC, EFTUD2 MBG probe: VIC-GGACATCCTTTGGCTTTTGA) at a final concentration of 900 nM primers and 250 nM probe. Primers and probe […]

call_split

Oto facial syndrome and esophageal atresia, intellectual disability and zygomatic anomalies expanding the phenotypes associated with EFTUD2 mutations

2013
Orphanet J Rare Dis
PMCID: 3727992
PMID: 23879989
DOI: 10.1186/1750-1172-8-110
call_split See protocol

[…] .ee) was used to design PCR-primers e23F (e23F: 5’-TTCAGTGAAGGACAGCATCG-3’) and e28R (e28R: 5’-TGGGGTAATTGAGCACAACA-3’) (Sigma-Aldrich, St. Louis, MO, USA), and the region covering exons 24–27 of the EFTUD2 gene was PCR-amplified (expected product size in wild-type transcript, 635 bp) using the JumpStart REDTaqReadyMix PCR Reaction kit (Sigma-Aldrich) with the following touch-down PCR condition: i […]

Citations

Looking to check out a full list of citations?

EFTUD2 institution(s)
The Children’s Hospital of Eastern Ontario Research Institute, University of Ottawa, Ottawa, ON, Canada; Department of Pediatrics, University of Ottawa, Ottawa, ON, Canada, [etc.]
EFTUD2 funding source(s)
Supported by Genome Canada; the Canadian Institutes of Health Research; the Ontario Genomics Institute; Ontario Research Fund; Genome Quebec; Children’s Hospital of Eastern Ontario Foundation; and a Resident Research Award from Physician’s Services Incorporated (PSI) Foundation.

EFTUD2 reviews

star_border star_border star_border star_border star_border
star star star star star

Be the first to review EFTUD2