EpiDesigner statistics

To access cutting-edge analytics on consensus tools, life science contexts and associated fields, you will need to subscribe to our premium service.

Subscribe
info

Citations per year

Citations chart
info

Popular tool citations

chevron_left Bisulfite primer design chevron_right
Popular tools chart
info

Tool usage distribution map

Tool usage distribution map
info

Associated diseases

Associated diseases

Protocols

To access compelling stats and trends, optimize your time and resources and pinpoint new correlations, you will need to subscribe to our premium service.

Subscribe

EpiDesigner specifications

Information


Unique identifier OMICS_28361
Name EpiDesigner
Interface Web user interface
Restrictions to use None
Input data A protein sequence.
Computer skills Basic
Stability Stable
Maintained Yes

Maintainer


  • person_outline EpiDesigner Team <>

Additional information


https://www.epidesigner.com/tutorial.html

EpiDesigner in pipelines

 (2)
2016
PMCID: 5073885
PMID: 27785156
DOI: 10.1186/s13148-016-0277-3

[…] in six genes covered by 71 cpgs was performed using the sequenom massarray epityper (sequenom inc, hamburg, germany). pcr primers (additional file : table s2) were designed using the sequenom epidesigner software (www.epidesigner.com). to reduce variability in dna methylation resulting from technical variation during pcr, each sample was amplified in triplicate and pooled prior […]

2013
PMCID: 3688651
PMID: 23708250
DOI: 10.1038/ni.2616

[…] were used if they contained at least 3 such positions. features were defined using the ensembl reference. promoters were defined as −5 kb to +1 kb from the tss., primers were designed using the epidesigner tool (http://www.epidesigner.com/). epityper assays were performed by the weill cornell medical college epigenomics core., all statistical analysis was performed using r software. […]


To access a full list of citations, you will need to upgrade to our premium service.

EpiDesigner in publications

 (151)
PMCID: 5945503
PMID: 29755673
DOI: 10.18632/oncotarget.25016

[…] quantitative methylation analysis an agena’s massarray platform was used. pcr primers for the amplification of the different regions of the kras locus downstream of exon 4a were designed by using epidesigner (agena) and their sequences and location were given, respectively, in and figure ., the pcrs were carried out in a 5 μl format with 10 ng/μl bisulfite-treated dna, 0.2 units of taqdna […]

PMCID: 5880910
PMID: 29636708
DOI: 10.3389/fpsyt.2018.00102

[…] a template for methylation-specific real-time pcr. the operating steps of quantitative real-time pcr were conducted according to instructions of the manufacturer. primers were designed based on the epidesigner software system (see figure ). the primers were used to detect methylated gene of the bdnf promoter i at relative cpg sites. β-actin gene was used as a reference control. the relative […]

PMCID: 5863829
PMID: 29588807
DOI: 10.1186/s13148-018-0472-5

[…] of this region were generated by polymerase chain reaction using the sodium bisulphite-converted dnas (zymo research, orange, ca) as the templates. the primers for this region were designed using epidesigner. the forward and backward primers were aggaagagagtattggggtttagattttaggaagg and cagtaatacgactcactatagggagaaggctcaaaatacaaaaaaattttctacctct. dna methylation level was quantified by honor […]

PMCID: 5862949
PMID: 29563500
DOI: 10.1038/s41467-018-03556-7

[…] epitpyer assays, 2 µg of genomic dna was bisulfite treated using an epitect plus bisulfite kit according to the manufacturer’s instruction (qiagen, leipzig, germany). pcr primers were designed using epidesigner (sequenom, http://www.epidesigner.com). pcr condition for epitpyer was: 15 min at 94 °c (for initial denaturation); 45 cycles of 94 °c for 20 s, 56–62 °c for 30 s, 72 °c for 60 s (for […]

PMCID: 5877761
PMID: 29562656
DOI: 10.3390/ijms19030900

[…] gold kit (zymo research corporation, orange, ca, usa) as described by the manufacturer., the pcr primers for rassf1a and atm amplicon sequences (see and ) were designed with the online tool “epidesigner” (http://www.epidesigner.com/start3.html). pcr was performed in a final reaction volume of 6 µl which included bisulfite-treated dna (10 ng/µl), coralload buffer (10×; qiagen, valencia, […]


To access a full list of publications, you will need to upgrade to our premium service.

EpiDesigner reviews

star_border star_border star_border star_border star_border
star star star star star

Be the first to review EpiDesigner