Computational protocol: Six1 Regulates MyoD Expression in Adult Muscle Progenitor Cells

Similar protocols

Protocol publication

[…] Chromatin immunoprecipitation assays were performed as described before , for both C2C12 and primary myoblasts. The antibodies used were rabbit anti-Six1 and normal rabbit IgG (Jackson Immunoresearch). For ChIP assays on transfected cells, a 9∶1 mixture of either wild-type or mutant reporter plasmid (described below) and puromycin resistance plasmid was transfected in C2C12 myoblasts using the polyethylenimine method . Cells were selected with puromycin for 7 days, resistant clones were pooled to generate polyclones and expanded, and chromatin was prepared as described before . PCR primer sequences used in ChIP are: CER-F: TGCTTCTTTCGGCCAAGTAT; CER-R: CCAACTGGCTGTGTTGTGAG; HoxD10-F: GAGAAATCGGACTCACCTTCC; HoxD10-R: CACATACCCAGGCAGAACG. For PCR to distinguish the endogenous CER and the CER transgene, primers were a- GTTGGGGGAAGGGGACAG; b- GACTCCAGGAAGGAAGAAGAGG; c- ACCCGTGACTCACAACACAG; d- TCTCCAGTGTCTACTCGAG. Quantitative PCR was performed on input chromatin from the wild-type and mutant polyclones and on a titration curve made with the pure reporter plasmid to ensure that the transgene copy numbers are comparable for both polyclones; the wild-type and mutant polyclones contain respectively 2.1 and 2.2 copies of transgene per cell (data not shown). Transgene ChIP data were analyzed as follows. First, qPCR titration curves made of input chromatin from the wild-type or the mutant polyclones were run in parallel to the ChIP samples, so “percent-of-input” values could be ascribed to each ChIP sample. Second, the percent of input values obtained with the non-specific antibody control (normal IgG) were subtracted from the percent-of-input values obtained with the other antibodies. Third, those IgG-subtracted percent-of-input values were reported as fractions of the values obtained with the wild-type CER polyclone.ChIP-seq experiments were performed on 50 million primary myoblasts in growth phase. Chromatin was fragmented to an average size of 200 bp and immunoprecipitated using rabbit anti-Six1 or a control rabbit IgG (Jackson). An input chromatin sample (prior to immunoprecipitation enrichment) was also prepared. After purification, sequencing libraries were prepared by the McGill University and Génome Québec Innovation Centre, and sequenced at 1 sample per lane on HiSeq2000. Sequencing reads were aligned to the mm9 mouse genome assembly using Bowtie in –n mode , allowing 0 mismatches in the first 36 nucleotides of each read, and removing reads that align at more than one location in the genome. Picard was used to filter out replicated reads (http://picard.sourceforge.net/). SeqMonk (http://www.bioinformatics.babraham.ac.uk/projects/seqmonk/) was used to extend reads to a length of 200 bp, to normalize read counts to the total number of retained reads in each sample, and to calculate normalized read densities for each sample in contiguous, non-overlapping bins of 25 base pairs. The read density in the input sample was finally subtracted from the immunoprecipitation samples. These read densities are given as wiggle format files as . A full description of the ChIP-seq results will be published elsewhere (Y.L. and A.B., in preparation). […]

Pipeline specifications

Software tools Bowtie, Picard, SeqMonk
Organisms Mus musculus