Computational protocol: Genomic and Phenomic Screens for Flower Related RING Type Ubiquitin E3 Ligases in Arabidopsis

Similar protocols

Protocol publication

[…] To curate putative RING-type ubiquitin E3 ligases in Arabidopsis thaliana genome version ARA11, classification made by Kosarev et al. () and Stone et al. () were used. To this end, the whole Arabidopsis proteome was downloaded from ARAPORT (https://www.araport.org/downloads/), and screened with InterProScan for protein families and domain architecture. To confirm that the newly identified RING domain containing protein sequences indeed represented ubiquitin E3 ligase type RING domains, InterProScan 5 (v5.16-55.0) Gene3D, SUPERFAMILY, ProSiteProfiles, SMART, Pfam, and ProSitePatterns signatures were used. Most of InterProScan tools use Hidden Markov Models (HMMs) to detect conserved domains along protein sequences. HMMs have been developed for conserved protein domains and they define for the software, which and where critical residues should be located along the analyzed protein sequence. From the protein domain collection, the ubiquitin E3 ligase type RING domains were filtered according to the criteria provided by Kosarev et al. () and Stone et al. () for canonical RING domains. Once the RING domains were identified, they were aligned with Jalview using ProbCons algorithm with two rounds of pre-training. The metal ligand binding residues were manually inspected and corrected, and small misalignments were edited. Sequences that failed to meet the criteria of InterProScan search engines were not considered in this study. [...] To associate the curated collection of 509 RING type ubiquitin E3 ligases with flowering the Genevestigator gene expression database software was used (Hruz et al., ). The experiments AT-00087, AT-00088, AT-00089, and AT-00090 containing developmental expression data of AtGenExpress initiative microarrays were selected for the analysis (Schmid et al., ). In the selected experiments, hybridization probes were available for 393 RING E3 genes out of the 509. From these experiments, the linear expression data was extracted for the developmental stages of developed rosette, bolting, young flower, developed flower, and flower and silique. For flower organs, the gene expression profiles were extracted for categories of shoot apical meristem (SAM), sepal, petal, stamen, and carpels. In these categories, genes were ranked for their at least 2-fold differential expression against the developed rosette. Their relative expression levels were obtained by log2(FC) = log2(FL) − log2(R), where FC is fold of change, FL is flower organ or development stage and R is rosette. The results for each category were sorted by their log2(FC) and all genes with log2(FC) > 1 were considered as up-regulated. [...] Homozygous one locus mutant lines were confirmed by segregation analysis and T-DNA specific PCRs. The PCR primers, T-DNA position and line information were summarized in Supplemental Table . The transcript levels of the T-DNA targeted genes were verified by quantitative real-time PCR (qPCR) analysis. The sample material for qPCR was harvested from the tissue indicated by Arabidopsis eFP Browser for each gene expression pattern: if the gene expression pattern indicated at least moderate expression in flower parts during floral development, tips of inflorescences with developing and open flowers were pooled from three to five individual plants. If the expression was in the seeds, young to mature siliques were pooled. If no expression data via eFP was found, new leaves were pooled with developing and open flowers. Three to four biological replications were harvested for each RNA preparation. RNA was extracted using InviTrap® Spin Plant RNA Kit (STRATEC Molecular), complementary DNA was prepared with SuperScript® IV Reverse Transcriptase (Thermo Fisher Scientific), and the qPCRs were performed using Roche Lightcycler® 480 Instrument II (Roche Diagnostics) using LightCycler® 480 SYBR Green I Master (Roche Diagnostics) with primers listed in Supplemental Table . Primers were primarily designed to locus downstream of the T-DNA. The fold up values (mutant line against Col-0) were calculated using the 2−ΔΔCT method according to Livak and Schmittgen (). Reference genes used in this study were the most stable Arabidopsis genes according to Czechowski et al. (): TIP41 LIKE (AT4G34270, forward: GTGAAAACTGTTGGAGAGAAGCAA, reverse: TCAACTGGATACCCTTT∧CGCA), AP2M (AT5G46630, forward: TTGAAAATTGGAGTACCGTACCAA, reverse: TCCCTCGTATACATCTGGCCA) and PTB1 (AT3G01150, forward: TTGAAGGAGTGGAATCTCACG, reverse: ATGTGCGGAAAGCAGATACC). Significance level of the qPCR were set at 0.1–0.5 FC for knock-down; <0.1 FC for knock-out; and >2 FC for up-regulated (Supplemental Table ). […]

Pipeline specifications