Similar protocols

Protocol publication

[…] D SMART™ RACE cDNA Amplification Kit (BD Biosciences). Pax7-specific primers used for 5′-RACE were 5′-GCACACTCCGTCCTTCAGCAGCTTG-3′ and 5′ - GCTGGAATGGCTACTTTACCG 3′, and for 3′-RACE were 5′-GAGACGGGTTCGATTCGTCCTGGAG–3′ and 5′– TAGCCAGGTAGTCCACAGCAC –3′. Purified products from Pax7 RACE experiments were subcloned into the pCR® 2.1-TOPO® vector (Invitrogen), transformed into One Shot® MACH1™ T1 Phage-Resistant Chemically Competent E. coli cells (Invitrogen), isolated with the QIAprep® Spin Miniprep Kit (Qiagen), and sequenced in both directions using either a Li-Cor-4200 L Global IR2 DNA or an Applied Biosystems automated DNA sequencer (Model 3100). Chromatogram traces were analyzed using the Vector NTI Suite 8.0 software (InforMax Inc.). Searches were performed using the Basic Local Alignment Search Tool (BLAST) network service from the National Center for Biotechnology Information (NCBI) (http://www.ncbi.nlm.nih.gov). Multiple sequence alignments were generated with ClustalW from the European Bioinformatics Institute (http://www.ebi.ac.uk/clustalw). The novel sequence described here and a transcript variant were submitted to NCBI and assigned accession numbers EU624121.2 and EU624121.1 for S. macrurus Pax7., Fresh-frozen tissue samples were pulverized with a mortar and pestle in liquid nitrogen and total protein lysates were prepared using lysis buffer (1% Igepal CA-630, 0.5% sodium deoxycholate, 0.1% SDS, 10 mM beta-mercaptoethanol, 10 µg/mL PMSF, 5 µg/mL aprotinin, 0.1 mg/mL benzamidine, 1 µg/mL pepstatin A, 1 µg/mL leupeptin, 100 mM sodium orthovanadate, 15 µL/mL Triton X-100®, in Phosphate Buffered Saline (PBS) pH 7.4) on ice for 45 min and homogenized by two 15-sec pulses. Lysates were centrifuged at 14,000 g for 10 min […]

Pipeline specifications