Computational protocol: Activation of Pax7 Positive Cells in a Non Contractile Tissue Contributes to Regeneration of Myogenic Tissues in the Electric Fish S. macrurus

Similar protocols

Protocol publication

[…] Heterologous degenerate oligonucleotide primers were designed for Pax7 based on respective GenBank vertebrate sequences using Dialign and CODEHOP. Pax7 primers corresponding to the PAPGQNYPRT (sense primer) and GKKDDDDDC (antisense primer) domains were designed using alignments from protein sequences of Danio rerio (GenBank: NP_571400), Salmo salar (GenBank: CAF02090.1), Tetraodon nigroviridis (GenBank: CAG07040.1), and two sequences from Salvelinus alpinus (GenBank: CAG25716.1; CAG25714.1). To clone partial Pax7 cDNAs from S. macrurus, we carried out reverse transcription (RT) and PCR separately. The RT reaction from 250–300 ng total RNA was performed for 50 min at 42°C using the SuperScript™ First-Strand Synthesis System for RT-PCR (Invitrogen, Carlsbad, CA). PCR amplification (1 µg of 1-week regeneration blastema cDNA) was carried out using PCR with annealing temperature 5°C below the calculated Tm for 35–40 cycles with Platinum® Taq DNA Polymerase (Invitrogen).RT-PCR products for Pax7 were PCR purified by gel extraction (Qiagen, Valencia, CA), subcloned into the Topo TA2.1 Plasmid (Invitrogen) or pGEMTeasy (Promega, Madison, WI) and transformed into Mach1 cells (Invitrogen) or JM109 cells (Promega). Plasmids from 10–20 cDNA clones of each transcript were isolated using the QIAprep® Spin Miniprep Kit (Qiagen), sequenced in both directions using a Li-Cor 4200 L Global IR2 DNA Sequencer or an Applied Biosystems automated DNA sequencer (Model 3100), and analyzed using the Vector NTI Suite 8.0 software (InforMax, Inc., Bethesda, MD). Upon verification of the cloned sequences obtained from 1-wk cDNA regeneration blastema, nondegenerate primers for the Pax7 transcript specific to S. macrurus were generated from the on-line Primer3 software program (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi). [...] RACE first-strand synthesis from total RNA (1 µg) of 1-week regeneration blastema was performed using the BD SMART™ RACE cDNA Amplification Kit (BD Biosciences). Pax7-specific primers used for 5′-RACE were 5′-GCACACTCCGTCCTTCAGCAGCTTG-3′ and 5′ - GCTGGAATGGCTACTTTACCG 3′, and for 3′-RACE were 5′-GAGACGGGTTCGATTCGTCCTGGAG–3′ and 5′– TAGCCAGGTAGTCCACAGCAC –3′. Purified products from Pax7 RACE experiments were subcloned into the pCR® 2.1-TOPO® vector (Invitrogen), transformed into One Shot® MACH1™ T1 Phage-Resistant Chemically Competent E. coli cells (Invitrogen), isolated with the QIAprep® Spin Miniprep Kit (Qiagen), and sequenced in both directions using either a Li-Cor-4200 L Global IR2 DNA or an Applied Biosystems automated DNA sequencer (Model 3100). Chromatogram traces were analyzed using the Vector NTI Suite 8.0 software (InforMax Inc.). Searches were performed using the Basic Local Alignment Search Tool (BLAST) network service from the National Center for Biotechnology Information (NCBI) (http://www.ncbi.nlm.nih.gov). Multiple sequence alignments were generated with ClustalW from the European Bioinformatics Institute (http://www.ebi.ac.uk/clustalw). The novel sequence described here and a transcript variant were submitted to NCBI and assigned accession numbers EU624121.2 and EU624121.1 for S. macrurus Pax7. [...] Images of immunolabeled tissue sections were visualized and captured on a BioRad 1024 confocal microscope (Bio-Rad Laboratories, Richmond, CA), controlled by OpenLab imaging software (Improvision, Lexington, MA). To quantify Pax7-positive cells in control versus regeneration, images from separate samples of proximal tissue at day 7 (n = 4), control (n = 3) and day 7 blastema (n = 3) were sampled using ImageJ. In each image, three different 100 µm2 areas with highest Pax7-positive density were converted to 8-bit and the threshold was modified to reflect positively labeled cells. For proximal and control samples, cells were manually counted using the cell counter plugin. Day 7 blastema was counted using the analyze particle function and the results were displayed to validate correct counts. Manual counting produced the same numbers as produced by the analyze particle plugin. Counts for each image were averaged and the average value from the set of images for each experimental condition were graphed with error bars representing the standard deviation. To quantify colocalization of Pax7 and BrdU, day 7, day 14, and control (n = 3) images were used. For each image, red and green channels were converted to 8-bit and the JACoP plugin was used to calculate Pearson’s coefficient. […]

Pipeline specifications

Software tools ImageJ, JACoP
Applications Laser scanning microscopy, Microscopic phenotype analysis
Organisms Episoriculus macrurus