Computational protocol: Drosophila FoxP Mutants Are Deficient in Operant Self-Learning

Similar protocols

Protocol publication

[…] Primers where designed using the software Primer3 0.4.0 (http://frodo.wi.mit.edu/). The first set of primers was designed as follows: FoxPIsoAfor (5′- AGTATTCCGAGGATGCCAAG-3′) and FoxPIsoArev (5′- CAAAACGGAAGGAGTTTGGA-3′), set on the gene CG16899, which amplified a 1347 bp product of Isoform A (NCBI acc. # JN160729) and a 1718 bp product of an intron-retention isoform (NCBI acc. # JN160730) of the FoxP gene. For sequencing exon 8 in the different strains, which is the one that changes between Isoform A and Isoform B of the FoxP gene of Drosophila (designated as CG32937 in the FlyBase), we used: FoxPIsoBfor (5′- AAGAATGCGATTCGTACGAAC-3′) and FoxPIsoBrev (5′-TATAATTTCCGAATCCGAACC-3′) which amplified a 532 bp fragment of the last exon (NCBI acc. # JN160731 and NCBI acc. # KF192848-KF192876). For all PCRs we used 1 µl of un-diluted cDNA of each strain. We ran a gradient PCR (50–65°C) with wild type Drosophila cDNA to determine the optimal annealing temperature. The PCR conditions were 94°C for 5 min, denaturation at 94°C for 5 s, annealing for 30 s at 60°C for Isoform A and 56.7°C for Isoform B, elongation for 2 min for Isoform A and 40 s for Isoform B at 72°C, 35 cycles, a last elongation at 72°C for 10 minutes. With this information we designed primers to amplify the full length FoxP isoforms of Drosophila melanogaster adding a restriction site for BamHI in the forward primer followed by the start sequence and FLAG-tag at the C′-terminal part of the protein followed by a Stop codon and EcoRI restriction site. We used the same forward primer for all isoforms, since the first six exons are shared. The forward primer we used was: sFOXPdm_for (5′- GGATCCGCCACCATGCATCGGATACATGACGACGAGTATTCCGAGGATGCCAAG-3′). For isoform A we used the eFOXP899_rev (5′-GCGGAATTCCTACTTATCGTCGTCATCCTTTAATCTTTGAGACCCACATACCC -3′) which amplified a 1374 bp fragment (NCBI acc. # KF206330). For the intron retention isoform we used the eFOXP_IR_rev (5′- GCGGAATTCCTACTTATCGTCGTCATCCTTGTAATCTGTTGCATAATATATAGA-3′) which amplified a 1222 bp (NCBI acc. # KF206329). Last, we used for the isoform B the reversed primer eFOXP937_rev (5′- GCGGAATTCCTACTTATCGTCGTCATCCTTGTAATCTCGATTGTGCTCATTGGC -3′) which amplified a fragment of 1608 bp fragment (NCBI acc. # KF206331). For all PCRs we used 1 µl of un-diluted cDNA of heads of Canton S wild type strain. For amplification of the full Open reading frame of the FoxP isoforms we used the High Fidelity PCR Enzyme Mix (#K0192; Lot 00116896). We used 5 µl of un-diluted cDNA in 50 µl final volume. We employed a HLA- PCR with the conditions 96°C for 1 min; followed by 5 cycles of 96°C for 25 seconds, 65°C for 45 seconds and 72°C for 1minute; followed by 25 cycles of 96°C for 25 seconds, 60°C for 45 seconds and 72°C for 1 minute; followed by 6 cycles of 96°C for 25 seconds, 55°C for 1 minute and 72°C for 2 minutes and a last cycle at 72°C for 10 minutes. PCR products were examined in 0.5% EtBr agarose gels, the specific bands were cut from the gel, and purified using QIAquick Gel Extraction Kit (Qiagen, Cat. 28706). PCR products were then cut using Fast digest BamHI and EcoRI enzymes (Fermentas) and cloned into pcDNA3.1 (−) vector (Invitrogen) cut with the same enzymes. These plasmids were transformed into One Shot Top 10 Escherichia coli chemically competent cells (Invitrogen, C404010) and colonies with ampicilin (100 µg/ml) resistance were selected on agarose plates. Clones with the specific insert were picked and grown overnight, at 37°C in 3 ml LB/ampicilin medium in a shaker. Plasmids were purified using Invisorb Spin Plasmid Mini Two columns (Invitek, Ref 1010140300) as described by the manufacturer. Finally, the inserts were fully sequenced and analyzed. [...] We designed QPCR primers specifically to distinguish between the different FoxP isoforms of Drosophila melanogaster (see for the position of the primers in the gene) and the hyperplastic discs gene (hyd, CG9484). Primers where designed using the software Primer3 0.4.0 (http://frodo.wi.mit.edu/). Primers for hyd covered an intron-exon boundary, the intron retention FoxP isoform spans from exon 6 to the intron between exon 6 and 7, isoform A and B forward primer was set between exon 6 and 7 (isoform A) and exon 6 and 8 (isoform B). The settings in Primer3 were: melting temperatures between 58°C and 62°C (ΔTm<1°C), GC content between 40 and 60% and amplicon length between 90 and 120 base pairs. The size, specificity and annealing temperature was tested in a gradient PCR and checked with gel electrophoresis. The PCR conditions were 94°C for 5 min, denaturation at 94°C for 5 s, annealing for 30 s at 55–65°C, elongation for 30 s at 72°C, 35 cycles, and a last elongation at 72°C for 10 minutes. PCR products were examined in 2% EtBr agarose gels, the specific bands were cut from the gel, and purified using QIAquick Gel Extraction Kit (Qiagen, Cat. 28706). PCR products were then cloned into pGEMTeasy plasmid (Promega, Cat. A1360). These plasmids were transformed into One Shot Top 10 Escherichia coli chemically competent cells (Invitrogen, C404010) and colonies with ampicilin (100 µg/ml) resistance were selected on agarose plates. Clones with the specific insert were picked and grown overnight, at 37°C in 3 ml LB/ampicilin medium in a shaker. Plasmids were purified using Invisorb Spin Plasmid Mini Two columns (Invitek, Ref 1010140300) as described by the manufacturer. Finally, the inserts were fully sequenced and analyzed. Additionally, two different house-keeping genes, EF1 and RPL32 were used to normalize the data. The different sets of primers used are: EMIsoA3for (5′-ACGCAGCTACGTGGAAGAAC-3′) and EMIsoA3rev (5′-TCATCGACAGTCCAAACTGC-3′) for amplification of 100 bp spanning the fragment from position 1103-1202 bp of the start codon of isoform A of FoxP between exon 6 and 7 (NCBI acc. # KF198509); EMIsoBqpcrfor (5′-GGTTCCAAAACACATTTTGCT-3′) and IRqPCR2rev (5′-GATAATATGGAGGAAAGAAGATTTACA-3′) which amplify a product of 94 bp, from 1070–1163 bp of the ORF of Intron retention isoform of FoxP from exon 6 to the intron between exon 6 and exon 7 (NCBI acc. # KF198508); IsoBqPCRfor (5′-TACGTGGAAGAATGCGATTC-3′) and EMIsoB10rev (5′-CATTATCGTCGACCATCCAA-3′) which amplify a 98bp fragment, from 1110–1207 bp of the ORF of isoform B of FoxP, between exon 6 and exon 8 (NCBI acc. # KF198507); HydQP2for (5′-ACGACGCTGGATAAGCAAAG-3′) and HydQP3rev (5′- AGATATCCAAATGGGGGACA-3′) which amplify a 97 bp fragment, from 951–1047 bp of the ORF of hyd (NCBI acc. # KF198506); and EF1 and RPL32 primers published in .For the QPCR analysis we used an Mx3005P system and the MxPRO QPCR program (Stratagene; Agilent Technologies, U.S.A.). Every sample was run in triplicate in a 96-well plate in a total volume of 25 µl. The mixture contained 12.5 µl of Kapa SYBR Fast Universal mix (Cat. No 07-KK4600-01 Code KM4100), 0.5 µl of Kapa SYBR Fast Rox Low ((50x) Code KD 4601), 5 µl of 1∶10 diluted cDNA, 450 nM of each primer and 4.5 µl Nuclease Free water. The QPCR conditions were: 95°C for 10 minutes, followed by 40 cycles of 95°C for 30 seconds, annealing/elongation at 60°C (for intron retention, isoform B, hyd and RPL32), 61°C (EF1) and 65°C (isoform A) for 30 seconds. The efficiency of each gene was determined for each treatment with the slope of a linear regression model using the MxPRO QPCR program. A standard curve was generated for each gene using the cloned QPCR fragment in pGem-T easy vector and as an internal normalization between plates we used the 1×105 dilution of the standard curve. We determined relative expression levels through normalization of the EF1 house keeping gene which gave the best coefficient of correlation for RNAi and mutant strains (comparing EF1, RPL32 and hyd) using the BestKeeper software tool. Relative expression levels were determined with the comparative cycle time (Ct) method. All primers used in this study amplified the cDNA with similar efficiency (E = 100+/−8%) in a validation experiment.ANOVA and a Tukey's Multiple Comparison post-hoc test was used to identify significant differences between strains in the FoxP expression with each isoform. […]

Pipeline specifications

Software tools Primer3, BestKeeper
Databases FlyBase
Applications qPCR, Non-coding RNA analysis
Organisms Drosophila melanogaster