Computational protocol: Population structure of honey bees in the Carpathian Basin (Hungary) confirms introgression from surrounding subspecies

Similar protocols

Protocol publication

[…] The cox1 intergenic region was PCR‐amplified with the newly designed (due to fail in PCR amplification with the commonly used primers) forward (5′‐CTGATATAGCATTCCCCCGAATA‐3′) and reverse (5′‐AGAATTGGATCTCCACGTCCTA‐3′) primers. These primers were designed from 2056 to 2401 nucleotide position detected in the A. m. ligustica complete mitochondrial genome (Acc. no.: L06178.1) (Crozier and Crozier ). The 10 μL reaction mix consisted of 1 μmol/L of each primer, 0.2 mmol/L of PCR nucleotide mix (Fermentas, Lithuania), 3 mmol/L MgCl2 (Applied Biosystem), 10× reaction buffer (Applied Biosystem, Waltham, MA), 0.75 U Taq polymerase (Applied Biosystem), and 20 ng/μL of template. The amplification cycle consisted of an initial denaturation step of 10 min at 95°C, followed by 35 cycles of 15 sec at 95°C, 30 sec at 63°C, and 30 sec at 73°C, followed by a final extension step of 25 min at 73°C. PCR products were purified using a Clean‐Up DNA fragment purification kit (A&A Biotechnology, Poland) and sequenced by the Eurofins MWG Operon Company (Ebersberg, Germany).Each sequence obtained was manually checked and aligned with the published sequences for comparison using ClustalX program (Thompson et al. ). Haplotype determination and diversity index numbers were calculated using DnaSP version 5.10 software (Librando and Rozas ). A neighbor‐joining phylogenetic tree of all the haplotypes was reconstructed using the Jukes‐Cantor model and 10.000 bootstrap replicates using MEGA version 6.0 software (Tamura et al. ). The best suitable nucleotide substitution model was selected using the jModelTest 0.1.1 program (Posada ). In the course of the edited phylogenetic tree, we have chosen Apis cerana as an out‐group (Acc. no.: DQ020237.1) (Tan et al. ). The haplotype network analysis was carried out using a median‐joining algorithm and the Network version 4.61 software package (http://www.fluxus-engineering.com). [...] Nine polymorphic microsatellite loci A7, A113, A107, A28, A88, A14, A35, A(B)24 (Estoup et al. ), and A43 (Garnery et al. ) were screened. The 25 μL reactions contained 1 μmol/L of each primer, 0.2 mmol/L of PCR dNTPs (Fermentas, Lithuania), 4.3 mmol/L MgCl2 (Promega, Fitchburg, WI), 5× reaction buffer (Promega, Fitchburg, WI), 0.8 U Taq polymerase (Promega, Fitchburg, WI), and 20 ng/μL of extracted DNA. The amplification cycle consisted of an initial denaturation step of 2 min at 94°C, followed by 35 cycles of 30 sec at 94°C, 30 sec at 55°C (A (B) 24, A43), 56°C (A28, A88), 57°C (A35), 58°C (A107, A14, A7), 60°C (A113), and 30 sec at 72°C, followed by a final extension step of 10 min at 72°C.Alleles were subsequently scored using PeakScanner version 1.0 software (Applied Biosystem). Population genetic parameters were calculated with GenAlEx 6.4 (Peakall and Smouse ) and Arlequin version 3.1 software (Excoffier et al. ). An exact test for genetic differentiation between populations using estimates of Fst was calculated using the FSTAT version 2.9.3. (Goudet ). The estimates of Nei's corrected standard genetic distance (Ds) (Nei ) were calculated with the PopGene package version 1.32 (Yeh et al. ).Principal coordinate analysis (PCoA) and assignment test (Paetkau et al. ) were also performed using GenAlEx version 6.4 (Peakall and Smouse ). The individual genetic distances were calculated to find and plot the relationships between the individuals belonging to the different populations.A clustering method was used for inferring population structure with STRUCTURE version 2.3.3. (Pritchard et al. ) software. This method estimated the posterior probability for a given number of K genetic populations, and an admixture model assuming correlated allele frequencies was used. In this study, the results were based on the simulations of 80.000 burn‐in steps and 1.000.000 MCMC (Markov chain Monte Carlo algorithm) iterations. Ten runs for each K value (2 ≤ K ≤ 10) were used, and the number of populations was reasoned from the value of ∆K as described in Evanno et al. (). […]

Pipeline specifications

Software tools Clustal W, DnaSP, MEGA, jModelTest, GenAlEx, Arlequin, POPGENE
Applications Phylogenetics, Population genetic analysis
Organisms Apis mellifera, Apis mellifera ligustica, Drosophila melanogaster