Computational protocol: Lacanobia oleracea nucleopolyhedrovirus (LaolNPV): A new European species of alphabaculovirus with a narrow host range

Similar protocols

Protocol publication

[…] In order to obtain genomic sequence information four genomic fragments were terminally sequenced. For this, two genomic libraries were constructed in pUC19 (New England Biolabs) using the EcoRI or PstI digested DNAs. Briefly, 2 μg of viral DNA extracted from purified OBs were digested with EcoRI or PstI overnight at 37°C and then heated to 65°C during 15 min to inactivate enzymes. A 5 μg sample of pUC19 vector was digested with EcoRI or PstI in the same conditions. The digested vector (20 μl) was dephosphorylated during 2h at 37°C using an alkaline phosphatase (Roche Life Science, Basel, Switzerland). After dephosphorylation, the DNA (100 μl) was purified in low melting agarose gel using commercial kit for gel extraction (PCR clean-up, gel extraction, Macherey-Nagel, Düren, Germany) following manufacture’s instructions. A 50 ng sample of the purified vector was ligated with 5 μl of the digested viral DNA (100 ng/μl of total fragmented DNA) using T4 DNA ligase (New England Biolabs) at 16°C overnight. After ligation, DH5α cells were transformed with the recombinant plasmids and plated on LB agar containing 100 μg/ml ampicillin, 1 μM IPTG and 80 μg/ml X-Gal. A total of 50 white colonies for each ligation were amplified in LB broth containing 100 μg/ml ampicillin. Plasmid DNAs were purified by alkaline lysis and screened for the presence of EcoRI or PstI inserts by digestion with the respective enzymes followed by electrophoresis in 1% agarose gel. Inserts were authenticated by comparing their migration in agarose gels with the fragments of the viral DNA generated by the digestion with the same enzymes.Two EcoRI and two PstI fragments (EcoRI-4Kb, EcoRI-6kb, PstI-5kb and PstI-6kb) were selected for terminal sequencing. Terminal nucleotide sequences were determined by Sanger Sequencing method performed by Stab Vida Company (Caparica, Portugal), employing standard M13 forward and M13 reverse primers. Sequence information was analyzed for the presence of open reading frames (ORFs) and for domain prediction using Clone Manager 9.0 (Scientific and Educational Software Server). Homology searches were performed both at the nucleotide and deduced amino acid levels, for all putative ORFs. DNA and protein comparisons with entries in the updated GenBank/EMBL, SWISS-PROT and PIR databases were performed using BLATn, BLASTp and FASTA programs [, ].For phylogenetic analyses, the DNA sequences within the coding regions of three highly conserved genes, the late expression factor 8 (lef-8), late expression factor 9 (lef-9) and polyhedrin (polh), were used [, , ]. As recommended by Jehle et al. [], for viruses with Kimura two-parameter (K-2-P) distances of more than 0.015 in the marker genes, the complete sequences of these three marker genes were determined and used in phylogenetic analyses. For this, primers were designed in the polh, lef-8 and lef-9 genes based on the genomic sequence of the most homologous NPV. The primer pairs used were MacoA-polh-F (ATGTATACCCGTTATAGTTA)-MacoA-polh-R (TTAGTAAGCCGGTCCGTTGTA), MacoA-lef8-F (ATGACGGACGTGATTGACGA)-MacoA-lef8-R (TCATCGAACCACTGTGTTGTG), and MacoA-lef9-F (ATGACCTTTAGCGGTCATTC)-MacoA-lef9-R (CTAGTCCAAAAACATGTCGA). The resulting fragments were cloned into pGEM-T Easy vector (Promega) following manufacturer’s instructions and transformed as previously described. Two clones for each gene were selected and nucleotide sequences were determined by Sanger Sequencing method performed by Stab Vida Company (Caparica, Portugal), employing standard SP6 and T7 reverse primers.The K-2-P distances were calculated for single and concatenated lef-8, lef-9 and polh genes. Concatenated sequences from the same virus were treated as a single sequence. Multiple sequence alignments were performed using MEGA6.06 software [], and the K-2-P nucleotide substitution model was used for the analysis. Maximum parsimony (MP) phylogenetic trees (1,000 bootstrap replicates) were inferred from the nucleotide sequence alignments using MEGA 6.06. Introduced gaps were treated as missing data.Genome sequences used in the comparative analysis were obtained from GenBank (accession number included as well as the publication): Autographa californica (Ac) MNPV (NC_001623/L22858 []), Agrotis ipsilon (Agip) NPV (NC_011345 []), Agrotis segetum (Agse) NPV (NC_007921 []), Bombyx mori (Bm) NPV (NC_001962 []), Chrysodeixis chalcites (Chch) NPV (NC_007151 []), Helicoverpa armigera multiple (HearM) NPV (NC_011615 []), Helicoverpa armigera single (HearS) NPV (AF303045 []), Helicoverpa zea (Hz) NPV (AF334030 []), Lymantria dispar (Ld) MNPV (AF081810 []), Mamestra brassicae (Mb) MNPV (NC_023681/JQ798165 []), Mamestra configurata A 90/2 (MacoA 90/2) NPV (U59461/AF467808 []), Mamestra configurata A 90/4 (MacoA 90/4) NPV (AF539999 []), Mamestra configurata B (MacoB) NPV (AY126275 []), Rachiplusia ou (Ro) MNPV (AY145471 []), Spodoptera exigua (Se) MNPV (AF169823 []), Spodoptera frugiperda (Sf) MNPV (HM595733 []), Spodoptera litura (Splt) NPV (NC_003102/AF325155 []) and Trichoplusia ni (Tn) NPV (NC_007383/DQ017380 []). [...] The host range of LaolNPV was determined by oral inoculation bioassays with the following lepidopteran species: M. brassicae, M. configurata, T. ni, C. chalcites, S. littoralis, S. frugiperda, S. exigua and H. armigera. The results of the oral inoculation studies were compared with those of MbMNPV, MacoNPV-A and MacoNPV-B. For this, second-instar larvae from the laboratory colonies were starved for 8–12 h at 26°C and then allowed to drink from an aqueous suspension containing 10% sucrose (w/v) and Fluorella blue and OBs at concentrations of 105 and 107 OBs/ml, following the droplet feeding method []. These concentrations were selected to permit determination of the susceptible host species based on preliminary tests (data not shown) and previous studies using MacoNPV [, , ] or MbMNPV [, ]. Larvae that ingested the suspension within 10 min, which were identified by the blue color of their intestine, were transferred to individual wells of a 25-well tissue culture plate with a cube (1 cm3) of semisynthetic diet []. Host range tests were performed using 25 larvae per virus concentration and 25 larvae treated with aqueous suspension containing sucrose and Fluorella blue without OBs as controls. Each assay comprised three replicates. Larvae were reared individually at 25°C and mortality was recorded every 24 h until the insects had either died or pupated. Dead larvae were examined microscopically to determine the presence of OBs. When present, OBs were purified from each group of dead larvae and viral DNA was extracted as previously described and subjected to REN analysis to determine the identity of the virus. The percentage of larval mortality was calculated for each virus and concentration and subjected to univariante analysis of variance (ANOVA) in SPSS v23 (IBM SPSS Statistics, Softtonic). The significance of treatments was determined for comparisons among the estimated means by Tukey test (p<0.05). […]

Pipeline specifications

Software tools BLASTP, MEGA, SPSS
Databases UniProt
Applications Miscellaneous, Phylogenetics
Organisms Mamestra configurata nucleopolyhedrovirus A, Mamestra brassicae multiple nucleopolyhedrovirus
Diseases Infection