FASTX-Toolkit protocols

View FASTX-Toolkit computational protocol

FASTX-Toolkit statistics

To access cutting-edge analytics on consensus tools, life science contexts and associated fields, you will need to subscribe to our premium service.

Subscribe
info

Citations per year

Citations chart
info

Popular tool citations

chevron_left Read quality control Adapter trimming File format conversion Read clustering File filtering V(D)J assignment File splitting chevron_right
Popular tools chart
info

Tool usage distribution map

Tool usage distribution map
info

Associated diseases

Associated diseases

FASTX-Toolkit specifications

Information


Unique identifier OMICS_01045
Name FASTX-Toolkit
Alternative name FastX toolkit
Software type Package/Module
Interface Command line interface
Restrictions to use None
Input format FASTA, FASTQ
Output format FASTA, FASTQ
Operating system Unix/Linux
License GNU Affero General Public License version 3
Computer skills Advanced
Stability Stable
Maintained Yes

Subtools


  • FASTA Formatter
  • FASTA Nucleotide Changer
  • FASTQ Information
  • FASTQ Masker
  • FASTQ Quality Filter
  • FASTQ Quality Trimmer
  • FASTQ-to-FASTA converter
  • FASTQ/A Barcode splitter
  • FASTQ/A Clipper
  • FASTQ/A Collapser
  • FASTQ/A Renamer
  • FASTQ/A Reverse-Complement
  • FASTQ/A Trimmer

Download


Versioning


Add your version

Maintainer


  • person_outline FASTX-Toolkit <>

FASTX-Toolkit in pipelines

 (274)
2018
PMCID: 5752202
PMID: 29297465
DOI: 10.7554/eLife.31216.024

[…] double digest (). primers used to make probe are listed in ., chip-seq data for the duplication strain were converted into fasta format, trimmed to 70 nt, and filtered for 70 nt long reads using fastx-toolkit (http://hannonlab.cshl.edu/fastx_toolkit). processed data were snp-parsed with hashmatch () using the mauriceville-oakridge snpome (fasta file listing both versions of each snp) (). […]

2018
PMCID: 5755174
PMID: 29301509
DOI: 10.1186/s12885-017-3945-6

[…] additional file : table s9). publicly available datasets used in this study are listed in supplementary additional file : table s9., raw reads were quality filtered and trimmed with fastx-toolkit (http://hannonlab.cshl.edu/fastx_toolkit/). bowtie v1.0.0 [] was used to align trimmed reads to hg38 human genome assembly with zero mismatches. alignment procedure was based on tailor […]

2018
PMCID: 5755174
PMID: 29301509
DOI: 10.1186/s12885-017-3945-6

[…] in rpkm were downloaded from http://gtexportal.org/ and normalized to actb expression. publicly available rna-seq libraries for fetal testis (additional file : table s9) were filtered with fastx-toolkit and a conventional tophat v2.0.9/cufflinks v2.1.1 pipeline with default parameters and reference annotation from ensembl release 83 was employed [–]., cell line tera1 (atcc htb-105) […]

2018
PMCID: 5756339
PMID: 29304863
DOI: 10.1186/s12931-017-0708-5

[…] illumina casava pipeline (released version 1.8, illumina) was used to obtain de-multiplexed sequencing reads (fastq files) passed the default purify filter. additional quality filtering used fastx-toolkit (http://hannonlab.cshl.edu/fastx_toolkit) to keep only reads that have at least 80% of bases with a quality score of 20 or more (conducted by fastq_quality_filter function) and reads […]

2018
PMCID: 5758801
PMID: 29311560
DOI: 10.1038/s41598-017-18308-8

[…] -o 10 -e 0.1 -q 30,30 -g aatgatacggcgaccaccgagatctacacgttcagagttctacagtccgacgatc –a tggaattctcgggtgccaaggaactccagtcac options. artifact reads were eliminated by the fastx_artifacts_filter command in fastx-toolkit (http://hannonlab.cshl.edu/fastx_toolkit/) version 0.0.13.2. we also discarded reads mapped to human rrna or trna by bowtie2 version 2.2.7 with -t - k 2–very-sensitive options. tophat […]


To access a full list of citations, you will need to upgrade to our premium service.

FASTX-Toolkit in publications

 (1334)
PMCID: 5954267
PMID: 29764375
DOI: 10.1186/s12864-018-4463-x

[…] our dbatm database., the ngs raw data for the rna-seq in sra format were converted to fastq format using the sra-toolkit v2.2.2 [] and the fastq format reads were cleaned to increase read quality by fastx-toolkit v0.0.13 (http://hannonlab.cshl.edu/fastx_toolkit/). first, reads with adapters were removed. second, the sequencing reads were scanned for quality at the reads tails. if the phred […]

PMCID: 5930818
PMID: 29716635
DOI: 10.1186/s12977-018-0417-2

[…] reads into unique reads, demultiplexing samples, discarding short reads (typically less than 15 nucleotides) and trimming the adaptors prior to mapping. one of the most commonly used tools is the fastx_toolkit (http://hannonlab.cshl.edu/fastx_toolkit/), which provides a number of functions to accomplish all of these steps. other alternatives, with more limited functions include cutadapt [], […]

PMCID: 5932639
PMID: 29755354
DOI: 10.3389/fphar.2018.00419

[…] read length of 301 bp., the reads were filtered using duk (http://duk.sourceforge.net/), quality trimmed with the fastqx-toolkit fastqtrimmer to remove low quality reads (https://github.com/agordon/fastx_toolkit). sequencing data was first assembled using velvet v. 1.2.07 (zerbino and birney, ), and the resulted contigs were then scaffolded with allpaths v. r46652 (butler et al., )., […]

PMCID: 5932338
PMID: 29755439
DOI: 10.3389/fmicb.2018.00818

[…] the small rna analysis and microrna prediction were performed as previously reported (). after the removal of poor-quality reads and adaptor sequences, clean reads were obtained with the fastx toolkit. small sequence reads were completely mapped to the genome of ph-1 from the ensembl fungi database using bowtie (). after removal of known non-coding rnas (rrna, trna, snrna, […]

PMCID: 5916929
PMID: 29695774
DOI: 10.1038/s41467-018-03766-z

[…] lane. cage reads were matched to their originating samples if barcodes matched identicaly. linker sequences were removed and reads were filtered, requiring at least 30 in 50% of the bases usingthe fastx-toolkit (http://hannonlab.cshl.edu/fastx_toolkit/) with the length of 25 bp. cage tags were mapped using bowtie (version 0.12.7) to the hg19 assembly using v = 2 and otherwise standard settings […]


To access a full list of publications, you will need to upgrade to our premium service.

FASTX-Toolkit review

star_border star_border star_border star_border star_border
star star star star star

Arup Ghosh

star_border star_border star_border star_border star_border
star star star star star
Desktop
The tools can calculate quality scores for Fastq files but the statistics are only limited to base calling the quality score. Also, fastx-toolkit has several modules for filtering out low-quality reads.