Computational protocol: Evidence for SH2 Domain-Containing 5′-Inositol Phosphatase-2 (SHIP2) Contributing to a Lymphatic Dysfunction

Similar protocols

Protocol publication

[…] Each pair of fastq files was aligned to human genome (hg19) using Novoalign (Novocraft Technologies; www.novocraft.com), keeping parameters at the default settings, as recommended by Novocraft Technologies. Novoalign, SAMtools (http://samtools.sourceforge.net) was used to sort the SAM files, create BAM files, and generate their index files. Picard (SourceForge; http://picard.sourceforge.net) was used to remove all of the PCR duplicates from the BAM files. For local realignments, base quality recalibration, and variant calling, we used Genome Analysis Toolkit (GATK) Version 2.2. Finally, for variant annotation, we used SnpEff (http://snpeff.sourceforge.net/), variant tools and ANNOVAR using multiple databases from UCSC Genome bioinformatics. Functional effects of each non-synonymous coding variant were evaluated using three different functional prediction algorithms: (1) Polyphen 2.0 Prediction of functional effects of human nsSNPs (http://genetics.bwh.harvard.edu/pph2), (2) SIFT and (3) MutationTaster (www.mutationtaster.org) using the dbNSFP database. Filtration of common polymorphisms was accomplished using frequencies from the NHLBI Exome sequencing project (ESP) (http://evs.gs.washington.edu/EVS) 1,000 Genomes Project (VCF Version 4; www.1000genomes.org/wiki/Analysis/Variant%20Call%20Format/vcf-variant-call-format-version-41). [...] Primers were designed using Oligo7 and Primer3 softwares for exome sequencing variants that were considered potentially relevant to the lymphedema phenotype. Polymerase chain reactions (PCRs) were performed using the Kapa HiFi HotStart ReadyMix DNA Polymerase (KapaBiosystems #KK2602) as per manufacturer's instructions. To visualize DNA fragments, 5 µL of the PCR product was loaded on a 1% agarose gel (or Lonza 1.2% agarose Flash Gel); ethidium bromide was used for staining. Purification of the DNA was done utilizing Qiagen Gel Extraction Kit (#28706) following manufacturer's instructions. Purified PCR products were sequenced at the University of Texas MD Anderson Cancer Center Genetic Core Facility using a 3730XL DNAnalyzer (AppliedBiosystems, Foster City, California, USA). Mutation INPPL1 (O15357) p.T180A was validated using primers 5′ GAGGCCTTCTAAGACCCCAC 3′ and 5′ GGTGTAATACATGGGGCTGG 3′. Mutation HGF (P14210) p.G315V was validated using primers 5′ TGATCAGAAATCCACCTAGGGAT 3′ and 5′ ACATGTGGAGGTAAAATGCATTTAA 3′. [...] Carefully following Duolink II instructions, cells were plated in chamber slides, allowed to adhere overnight, starved for 4 hours and stimulated with appropriate growth factors. Cells were then fixed using 4% paraformaldehyde (VWR) followed by permeabalization with 1% (w/v) Triton-X in PBS. Anti-DDK mouse monoclonal antibody (Origene) was combined with either rabbit polyclonals cMET or VEGFR3 (C28 and C20 respectively, SCBT). Following PLA protocol, cells were counterstained with DAPI and Alexa-Flour Phalloidin. Fluorescence spots were quantified using ImageJ software (NIH). For immunofluorescence, cells were serum-starved, stimulated, fixed and permeabilized as described above. Immunofluorescence cytochemistry was done using rabbit anti-SHIP2 antibody (Cell Signal) for determining expression of SHIP2 in LEC and anti-PIP3 IgG antibody (Echelon Biosciences) to determine cellular levels of PtdIns(3,4,5)P3. Cells were counterstained with either Alexa Flour 488 or 594 phalloidin (Invitrogen) to show actin localization and either DRAQ5 (Biostatus) or DAPI (Invitrogen) to show cell nucleus. Cells were visualized using either confocal laser microscope (Leica), epifluorescence inverted microscope (Leica) or EVOS FL microscope (Invitrogen). [...] The statistical analysis was performed using SigmaPlot 11.0. Student t-test and one way ANOVA were used to evaluate the data. Data are expressed as means ± SEM. All in vitro experiments independently repeated at least 3 times. p values of <0.05 were considered statistically significant. […]

Pipeline specifications

Software tools NovoAlign, SAMtools, Picard, GATK, SnpEff, vtools, ANNOVAR, PolyPhen, MutationTaster, Primer3
Databases dbNSFP
Applications WES analysis, qPCR
Organisms Homo sapiens
Diseases Autoimmune Diseases, Liver Diseases, Lymphatic Diseases, Lymphedema, Neoplasms, Vascular Diseases, Lymphatic Abnormalities