flyCRISPR statistics

Tool stats & trends

Looking to identify usage trends or leading experts?

Protocols

flyCRISPR specifications

Information


Unique identifier OMICS_08499
Name flyCRISPR
Interface Web user interface
Restrictions to use None
Input data Single target region seq
Computer skills Basic
Stability Stable
Maintained Yes

Taxon


  • Invertebrates
    • Drosophila melanogaster

Publication for flyCRISPR

flyCRISPR citations

 (34)
library_books

A Distalless responsive enhancer of the Hox gene Sex combs reduced is required for segment and sex specific sensory organ development in Drosophila

2018
PLoS Genet
PMCID: 5909922
PMID: 29634724
DOI: 10.1371/journal.pgen.1007320

[…] igated into AscI and StuI sites of pGX-2attp_WN vector []. Subsequently the 5'-homology arm was ligated into pGX-2attp_WN vector containing the 3'-homology arm. sgRNA were designed using http://tools.flycrispr.molbio.wisc.edu/targetFinder/ as described [] and cloned into the U6b-sgRNA-short vector as previously described []. sgRNA primer sequences are listed in . Transgenic flies were generated by […]

call_split

Drosophila Gr64e mediates fatty acid sensing via the phospholipase C pathway

2018
PLoS Genet
PMCID: 5821400
PMID: 29420533
DOI: 10.1371/journal.pgen.1007229
call_split See protocol

[…] to generate Gr64af flies []. We selected two target sites for deletion of the whole Gr64 cluster using DRSC Find CRISPRs (http://www.flyrnai.org/crispr) and CRISPR optimal target finder (http://tools.flycrispr.molbio.wisc.edu/targetFinder): one near the 5’ end of Gr64a (GAATCCTCAACAAACTTCGGTGG, the Protospacer Adjacent Motif is underlined) and one near the 3’ end of Gr64f (GGTCGTTGTCCTCATGAAATTGG) […]

library_books

highroad Is a Carboxypetidase Induced by Retinoids to Clear Mutant Rhodopsin 1 in Drosophila Retinitis Pigmentosa Models

2018
Cell Rep
PMCID: 5832065
PMID: 29425495
DOI: 10.1016/j.celrep.2018.01.032

[…] iated cassette exchange (RMCE) following a published protocol (; further details in ).To generate hiro deletion mutants, we followed the homology-directed repair CRISPR-Cas9 protocol described in www.flycrispr.molbio.wisc.edu (further details in ). The deletion of hiro was further confirmed through genomic PCR. This hiroF1 allele was recombined with ninaEG69D to generate hiroF1, ninaEG69D/TM6B, wh […]

library_books

Chaski, a novel Drosophila lactate/pyruvate transporter required in glia cells for survival under nutritional stress

2018
Sci Rep
PMCID: 5775259
PMID: 29352169
DOI: 10.1038/s41598-018-19595-5

[…] 545 stock from Kyoto Stock Center). CRISPR mutant was generated following the method of genetically encoding the gRNAs. We designed two gRNAs using the CRISPR optimal target finder tool (http://tools.flycrispr.molbio.wisc.edu/targetFinder/index.php). Both gRNAs sequences are close to the ATG. A BamH1 restriction site near to the target sequences was used later for selection. Sense and antisense ol […]

call_split

An Ichor dependent apical extracellular matrix regulates seamless tube shape and integrity

2018
PLoS Genet
PMCID: 5774827
PMID: 29309404
DOI: 10.1371/journal.pgen.1007146
call_split See protocol

[…] Optimal gRNA target sites in the Drosophila melanogaster genome (release 6) were selected using the default settings of the flyCRISPR Optimal Target Finder web program (http://tools.flycrispr.molbio.wisc.edu/targetFinder/). Genomic DNA from a w1118; FRT40A FRTG13 stock (Bloomington Stock Center) was isolated using a Qiagen […]

call_split

A population of adult satellite like cells in Drosophila is maintained through a switch in RNA isoforms

2018
eLife
PMCID: 5919756
PMID: 29629869
DOI: 10.7554/eLife.35954.020
call_split See protocol

[…] CCACTGGATTCCACGGCTTTTCG 3’– Homology arm 2: Fwd. 5’ GGTAGCTCTTCTTATATAACCCGGCGACCTCCTCG3’- Rev. 5’GGTAGCTCTTCTGACC GGACGAAAAACTAGCGACC) and cloned into the pDsRed-attP (Addgene #51019) vector (http://flycrispr.molbio.wisc.edu/protocols/pHD-DsRed-attP). Both constructs were injected into nos-Cas9 (BL54591) embryos. Flies with ∆Enh3 were identified via the expression of the Ds-Red in the eyes and co […]

Citations

Looking to check out a full list of citations?

flyCRISPR institution(s)
Genetics Training Program, University of Wisconsin, Madison, WI, USA

flyCRISPR reviews

star_border star_border star_border star_border star_border
star star star star star

Be the first to review flyCRISPR