FlyRNAi statistics

Tool stats & trends

Looking to identify usage trends or leading experts?

Protocols

FlyRNAi specifications

Information


Unique identifier OMICS_11006
Name FlyRNAi
Restrictions to use None
Database management system MySQL
Community driven No
Data access Browse
User data submission Not allowed
Maintained Yes

Taxon


  • Invertebrates
    • Drosophila melanogaster

Maintainer


  • person_outline Ian Flockhart

Publications for FlyRNAi

FlyRNAi citations

 (37)
library_books

A high throughput, functional screen of human Body Mass Index GWAS loci using tissue specific RNAi Drosophila melanogaster crosses

2018
PLoS Genet
PMCID: 5897035
PMID: 29608557
DOI: 10.1371/journal.pgen.1007222

[…] gene symbols (http://www.ncbi.nlm.nih.gov/gene/), we identified the closest Drosophila orthologs to each of these human genes according to DIOPT—DRSC Integrative Ortholog Prediction Tool (http://www.flyrnai.org/diopt)[], as well as pairwise alignments generated using BLAST of NCBI (for example: http://www.ncbi.nlm.nih.gov/homologene/?term=ADCY9). In Step 4, we obtained available RNAi knockdown li […]

library_books

Integrated biology approach reveals molecular and pathological interactions among Alzheimer’s Aβ42, Tau, TREM2, and TYROBP in Drosophila models

2018
Genome Med
PMCID: 5875009
PMID: 29598827
DOI: 10.1186/s13073-018-0530-9

[…] ic process, nucleus, organelle part, and macromolecular complex, which account for 14.6%, 12.2%, 10%, 8.8%, and 7.2% of the 10,938 high confidence human orthologous genes (DIOPT score > 1; http://www.flyrnai.org/cgi-bin/DRSC_orthologs.pl) accordingly, with FDR adjusted FET p value < 1.2E-58. In contrast, the immune system genes only account for < 1.1% of the orthologs and were not enriched (FET p […]

library_books

RNA Interference (RNAi) Screening in Drosophila

2018
Genetics
PMCID: 5844339
PMID: 29487145
DOI: 10.1534/genetics.117.300077

[…] hila Stock Center (BDSC), and the National Institute of Genetics (NIG) distribute different libraries to researchers worldwide (; ; ; ; ). These resources and further information can be found at: www.flyrnai.org, http://stockcenter.vdrc.at, http://flystocks.bio.indiana.edu, https://shigen.nig.ac.jp/fly/nigfly/, and http://flybase.org. These collections and all associated information can also be se […]

library_books

Tools Allowing Independent Visualization and Genetic Manipulation of Drosophila melanogaster Macrophages and Surrounding Tissues

2018
PMCID: 5844306
PMID: 29321168
DOI: 10.1534/g3.117.300452

[…] : 5′-TCCACCTATCGCATTAAACACC-3′ and 5′-ACAGTCCCTCACAATACGGTT-3′.RpL32: 5′-AGCATACAGGCCCAAGATCG-3′ and 5′-TGTTGTCGATACCCTTGGGC-3′.These four sets of primers were obtained from FlyPrimerBank (http://www.flyrnai.org/FlyPrimerBank). qPCR was run on a LightCycler 480 (Roche) and data were analyzed using LightCycler 480 Software and Prism.mCherry: 5′-ACATCCCCGACTACTTGAAGC-3′ and 5′ ACCTTGTAGATGAACTCGCCG- […]

library_books

A gene specific T2A GAL4 library for Drosophila

2018
eLife
PMCID: 5898912
PMID: 29565247
DOI: 10.7554/eLife.35574.023

[…] Gold collection and prioritized the genes if their human ortholog(s) are disease-related (). We also prioritized genes based on the nomination from scientific community through a web site (http://www.flyrnai.org/tools/crimic/web/). sgRNA targeting the qualified CDS introns were selected based on their efficiency score and specificity annotated at Find CRISPR Tool (). The homology arms upstream or […]

call_split

A population of adult satellite like cells in Drosophila is maintained through a switch in RNA isoforms

2018
eLife
PMCID: 5919756
PMID: 29629869
DOI: 10.7554/eLife.35954.020
call_split See protocol

[…] performed according to (). For generating guide RNAs, two protospacers were selected (sgRNA1 GCATTCCGCAGGTTTAGTCAC and sgRNA2 GCGATAACCCGGCGACCTCC) flanking 5’ and 3’ Enhancer-3 regions, (http://www.flyrnai.org/crispr/). The protospacers were cloned into the tandem guide RNA expression vector pCFD4 (Addgene #49411) (http://www.crisprflydesign.org/wp-content/uploads/2014/06/Cloning-with-pCFD4.pdf) […]

Citations

Looking to check out a full list of citations?

FlyRNAi institution(s)
Department of Genetics, Harvard Medical School, Boston, MA, USA; Drosophila RNAi Screening Center and Transgenic RNAi Project, Harvard Medical School, Boston, MA, USA; Marine Science Center, Northeastern University, Nahant, MA, USA; Howard Hughes Medical Institute, Boston, MA, USA
FlyRNAi funding source(s)
This work was supported by NIH NIGMS [R01 GM067761, NIGMS R01 GM084947]; NIH [R24 RR032668, R24 OD021997]; Dana Farber/Harvard Cancer Center [NCI Cancer Center Support Grant # NIH 5 P30 CA06516]; Howard Hughes Medical Institute.

FlyRNAi reviews

star_border star_border star_border star_border star_border
star star star star star

Be the first to review FlyRNAi