Full Length cDNA statistics

Tool stats & trends

Looking to identify usage trends or leading experts?

Protocols

Full Length cDNA specifications

Information


Unique identifier OMICS_22547
Name Full Length cDNA
Restrictions to use None
Community driven No
Data access File download
User data submission Not allowed
Maintained Yes

Taxon


  • Primates
    • Homo sapiens

Full Length cDNA citations

 (895)
library_books

AID/APOBEC like cytidine deaminases are ancient innate immune mediators in invertebrates

2018
Nat Commun
PMCID: 5956068
PMID: 29769532
DOI: 10.1038/s41467-018-04273-x

[…] k (non-permanent accession numbers XM_011676409 and XM_011676403). We subsequently focused on the functional genes/transcripts: SpAIDL1, 2, 3, 4a, and 9. To determine the complete ORF of SpAIDL9, the full-length cDNA sequence of this transcript was obtained by 5′ and 3′ RACE (Genbank KY241384 and KY241385). Finally, to eliminate the possibility that the functional SpAIDL genes (SpAIDL1, 2, 3, 4a, […]

call_split

Heterologous expression of ZjOMT from Zoysia japonica in Escherichia coli confers aluminum resistance through melatonin production

2018
PLoS One
PMCID: 5937781
PMID: 29734371
DOI: 10.1371/journal.pone.0196952
call_split See protocol

[…] Full-length cDNA sequence of ZjOMT was amplified using gene-specific primers ZjOMT-F: GGCACTGGGCCTGGACCAAGGATT and ZjOMT-R: CGCAGACTTAATATATACGAAGAAAC which were designed according to the Zoysia Genom […]

library_books

Epizootic Hemorrhagic Disease Virus Serotype 6 Infection in Cattle, Japan, 2015

2018
PMCID: 5938786
PMID: 29664367
DOI: 10.3201/eid2405.171859

[…] segment 2, which correlates with serotype, and segment 3, which correlates with geographic genetic type, of outbreak isolate HG-1/E/15. We designed RT-PCR primers to amplify segments 2 and 3 from the full-length cDNA on the basis of sequence data of EHDV strains from Japan and Australia available in GenBank. We performed RT-PCR using RNA obtained from an affected cow (no. 9; ) as template; we then […]

call_split

A comprehensive omics analysis and functional survey of cuticular proteins in the brown planthopper

2018
Proc Natl Acad Sci U S A
PMCID: 5960286
PMID: 29712872
DOI: 10.1073/pnas.1716951115
call_split See protocol

[…] i.nlm.nih.gov/, BioProject PRJNA177647; 27,571 coding protein sequences) and transcriptomic databases (https://www.ncbi.nlm.nih.gov/sra, accession no. SRX023419; 21,908 coding protein sequences). The full-length cDNA sequences were obtained from transcriptomic databases, and most of them were confirmed by RT-PCR. The full cDNA sequences of some CP genes were cloned by using RACE core sets (catalog […]

library_books

Characterization of a novel organic solute transporter homologue from Clonorchis sinensis

2018
PLoS Negl Trop Dis
PMCID: 5942847
PMID: 29702646
DOI: 10.1371/journal.pntd.0006459

[…] production. The target region was amplified by PCR using forward primer (5′-GATATGGATCCCTCGGTCCCAATCGCCGTC–3′) and reverse primer (5′–CTGCGAAGCTTTAGAGTGACAAACGGATCTTGG–3′). The PCR template was CsOST full-length cDNA. The PCR product was purified with QIAquick PCR purification kit (QIAGEN) and subcloned into the pET-23a(+) vector (Novagen, Darmstadt, Germany) containing a 6× histidine tag.After tr […]

call_split

Transcription Factor SmWRKY1 Positively Promotes the Biosynthesis of Tanshinones in Salvia miltiorrhiza

2018
Front Plant Sci
PMCID: 5934499
PMID: 29755494
DOI: 10.3389/fpls.2018.00554
call_split See protocol

[…] WRKY1 by combination with the reverse primer AUAP using rapid amplification of cDNA ends (RACE) as reported before (; ; ). 5′-sequence and 3′-terminal products was aligned and assembled to obtain the full-length cDNA sequence of the putative SmWRKY1 gene. Primer pairs SmWRKY1-KF and SmWRKY1-KR were synthesized for amplification of the full ORF of SmWRKY1 according to the procedure as described bel […]

Citations

Looking to check out a full list of citations?

Full Length cDNA reviews

star_border star_border star_border star_border star_border
star star star star star

Be the first to review Full Length cDNA