G2F statistics

Tool stats & trends

Looking to identify usage trends or leading experts?

Protocols

G2F specifications

Information


Unique identifier OMICS_18549
Name G2F
Alternative name Gene2Function
Restrictions to use None
Community driven No
Data access File download, Browse
User data submission Not allowed
Version 0.9.3
Maintained Yes

Maintainer


  • person_outline Norbert Perrimon

Additional information


This database is available under a beta version.

Publication for Gene2Function

G2F citations

 (9)
library_books

Use of a Deep Recurrent Neural Network to Reduce Wind Noise: Effects on Judged Speech Intelligibility and Sound Quality

2018
PMCID: 5949931
PMID: 29708061
DOI: 10.1177/2331216518770964

[…] plying the normalized cross-correlation operation to the gammatone filterbank outputs for the two microphone signals. The normalized cross-correlation for correlation lag l is given by: (4)C(l,f)=rg1fg2f(l,f)rg1fg1f(0)rg2fg2f(0);f=1,…,32 (5)rg1fg2f(l,f)=∑k=-N+1Ng1f(k-l)g2f(k);f=1,…,32 (6)rgifgif(l,f)=∑k=-N+1Ngif(k-l)gif(k);f=1,…,32,i=1,2 where g1f and g2f are samples obtained from filtering each f […]

library_books

Cyclodextrin assisted synthesis of tailored mesoporous silica nanoparticles

2018
Beilstein J Nanotechnol
PMCID: 5827706
PMID: 29527443
DOI: 10.3762/bjnano.9.64

[…] ethesda, MD, USA). Energy-dispersive X-ray spectroscopy (EDX) was used to determine the elemental composition of the MSN samples at 30 kV and 4.5 mA. Transmission electron microscopy (TEM, FEI Tecnai G2F30) analysis was performed on the particles, which were dispersed in water, and a tiny droplet was dried on a TEM grid. The particles were imaged at 300 kV. STEM images were captured using a high-a […]

call_split

Weaker HLA Footprints on HIV in the Unique and Highly Genetically Admixed Host Population of Mexico

2018
J Virol
PMCID: 5752930
PMID: 29093100
DOI: 10.1128/JVI.01128-17
call_split See protocol

[…] ishing with 5 min at 72°C. All positive gag products confirmed by agarose gel electrophoresis were purified using a QIAquick PCR purification kit (Qiagen). Sequences were obtained with eight primers (G2F, GCGGCGACTGGTGAGTA [734 to 750]; GS1R, TTATCTAAAGCTTCCTTGGTGTCT [1074 to 1097]; GAS3F, CATCAATGAGGAAGCTGCAG [1401 to 1420]; GAS4R, GGTTCTCTCATCTGGCCTGG [1462 to 1481]; GAS5F, CTCTAAGAGCCGAGCAAGCT […]

library_books

Surface Decoration of Pt Nanoparticles via ALD with TiO2 Protective Layer on Polymeric Nanofibers as Flexible and Reusable Heterogeneous Nanocatalysts

2017
Sci Rep
PMCID: 5645354
PMID: 29042622
DOI: 10.1038/s41598-017-13805-2

[…] e Pt-NP on the nanofiber surface. For this, samples were dispersed in ethanol by using vortex and then small amount of this dispersion is dropped on the porous carbon coated TEM grid. TEM (FEI-Tecnai G2F30) and elemental analysis (energy dispersive X-ray spectroscopy, EDX) was carried out for Pt-NP/TiO2-PAN nanofibers. The surface analyses of the samples were performed by using X-ray photoelectron […]

library_books

Bayesian ABC MCMC Classification of Liquid Chromatography–Mass Spectrometry Data

2017
Cancer Inform
PMCID: 5224349
PMID: 28096647
DOI: 10.4137/CIN.S30798

[…] r protein concentration variations in each class. Accordingly, the protein expression level for the lth protein in the jth sample profile is modeled as cljpro~{N([γ1,γ2,…,γNpro],Σ),ifj∈class0,N([γ1f1,γ2f2,…,γNprofNpro],Σ),ifj∈class1.(3)In this paper, we assume a diagonal covariance matrix Σ=[σlk2]Npro×Npro such that protein concentrations are mutually independent (the results will still be approx […]

library_books

Fast interfacial charge transfer in α Fe2O3−δCδ/FeVO4−x+δCx−δ@C bulk heterojunctions with controllable phase content

2016
Sci Rep
PMCID: 5141511
PMID: 27924929
DOI: 10.1038/srep38603

[…] roscopy (XPS, XSAM800, Japan) were used. The morphologies were observed on a field emission scanning electron microscopy (FE-SEM, S4800, Japan) and a transmission electron microscopy (TEM, FEI TECNAI G2F20 S-TWIN, U.S.A.). The zeta potential was measured by a Nano Particle size and zeta potential analyzer (NAMO-ZS, Malvern, UK). The UV−vis diffuse reflectance spectra (DRS, Cary 5000, Agilent, U.S. […]

Citations

Looking to check out a full list of citations?

G2F institution(s)
Drosophila RNAi Screening Center, Dept. of Genetics, Harvard Medical School, Boston, MA, USA; The FlyBase Consortium, Harvard University, Cambridge, MA, USA; Howard Hughes Medical Institute, MD, USA

G2F reviews

star_border star_border star_border star_border star_border
star star star star star

Be the first to review G2F