GeneDesign statistics

Tool stats & trends

Looking to identify usage trends or leading experts?

Protocols

GeneDesign specifications

Information


Unique identifier OMICS_08709
Name GeneDesign
Interface Web user interface
Restrictions to use None
Programming languages C, Perl
Computer skills Basic
Version 3.0
Stability Stable
Maintained Yes

Maintainer


  • person_outline Sarah M. Richardson

Publications for GeneDesign

GeneDesign citations

 (61)
library_books

Carbonate Apatite Nanoparticles Act as Potent Vaccine Adjuvant Delivery Vehicles by Enhancing Cytokine Production Induced by Encapsulated Cytosine Phosphate Guanine Oligodeoxynucleotides

2018
Front Immunol
PMCID: 5916113
PMID: 29720976
DOI: 10.3389/fimmu.2018.00783

[…] K-type CpG ODNs (CpG K3: 5′-atcgactctcgagcgttctc-3′) and Alexa 488-labeled K-type CpG ODNs (Alexa 488-labeled CpG K3) were purchased from GeneDesign (Osaka, Japan). EndoGrade endotoxin-free ovalbumin (OVA) (<0.1 EU/mg protein) purchased from Hyglos GmbH (Bayern, Germany) was used for immunization. Grade V OVA purchased from Sigma-Aldric […]

library_books

Artificial cationic oligosaccharides for heteroduplex oligonucleotide type drugs

2018
Sci Rep
PMCID: 5847598
PMID: 29531343
DOI: 10.1038/s41598-018-22161-8

[…] s in the NMR spectra compared with acetonitrile (internal standard). DNA, RNA, and other nucleic acid oligomers were purchased from Japan Bio Services Co., Ltd., Hokkaido System Science Co., Ltd., or GeneDesign, Inc. […]

library_books

Activated CD8+ T cell extracellular vesicles prevent tumour progression by targeting of lesional mesenchymal cells

2018
Nat Commun
PMCID: 5789986
PMID: 29382847
DOI: 10.1038/s41467-018-02865-1

[…] miRNA First-Strand Synthesis Kit (Clonetech). RT-qPCR was performed using the StepOnePlus Real-Time PCR system (Applied Biosystems) with SYBR Advantage qPCR Premix (Clonetech) and synthetic primers (GeneDesign: miR-298–5p; GGCAGAGGAGGGCTGTTCTTCCC). The quantity of each miRNA was measured by the comparative Ct method (the ⊿⊿Ct method). The level of each miRNA was normalised to that of a U6 snRNA c […]

call_split

A combinatorial approach to synthetic transcription factor‐promoter combinations for yeast strain engineering

2017
PMCID: 5873372
PMID: 29084380
DOI: 10.1002/yea.3292
call_split See protocol

[…] operator sequences × 10 basal promoters × 2 promoter lengths. Sequences of all hybrid promoter parts are listed in Table .For each hybrid promoter, oligomers for DNA synthesis were designed using the GeneDesign suite (Richardson, Nunley, Yarrington, Boeke, & Bader, ); however, for 60 promoters the resulting sequences were deemed too difficult to synthesize owing to the presence of multiple DNA syn […]

library_books

Hydrogen peroxide triggered gene silencing in mammalian cells through boronated antisense oligonucleotides† †Electronic supplementary information (ESI) available: Full experimental details, 1H, 13C and 31P spectra of all new compounds, HPLC charts, ESI MS spectra of all new ODNs and representative UV melting data. See DOI: 10.1039/c7sc04318j

2017
PMCID: 5875086
PMID: 29629168
DOI: 10.1039/c7sc04318j

[…] ere recorded on a JASCO P-2200 instrument. FAB mass spectra were measured using a JEOL JIM-700 mass spectrometer. Solid-phase ODN synthesis was performed using an nS-8 II oligonucleotide synthesizer (GeneDesign, Osaka, Japan). MALDI-TOF mass spectra were recorded on an ultrafleXtreme mass spectrometer (Bruker Daltonics, Billerica, MA, USA). ESI mass spectra were recorded on a Xevo G2-XS QTof (Wate […]

library_books

The intratracheal administration of locked nucleic acid containing antisense oligonucleotides induced gene silencing and an immune stimulatory effect in the murine lung

2017
PLoS One
PMCID: 5673232
PMID: 29107995
DOI: 10.1371/journal.pone.0187286

[…] Locked nucleic acid antisense oligonucleotides (LNA-ASOs) complementary to the mouse Scarb1 or ApoB mRNA were chemically synthesized by GeneDesign, Inc. (Osaka, Japan).The sequences of the ASOs were as follows.Scarb1: LT^LC^A^G^T^C^A^T^G^A^C^T^LT^LCApoB: LG^LC^A^T^T^G^G^T^A^T^LT^LC^LAA, T, G, C: DNA; ^: Phosphorothioate bond; LN: LNA; […]

Citations

Looking to check out a full list of citations?

GeneDesign institution(s)
Johns Hopkins University, Baltimore, MD, USA

GeneDesign reviews

star_border star_border star_border star_border star_border
star star star star star

Be the first to review GeneDesign