iDBPs statistics

info info

Citations per year

info

Popular tool citations

chevron_left Protein-DNA interaction prediction chevron_right
info

Tool usage distribution map

Tool usage distribution map
info info

Associated diseases

Associated diseases
Want to access the full stats & trends on this tool?

iDBPs specifications

Information


Unique identifier OMICS_03575
Name iDBPs
Interface Web user interface
Restrictions to use None
Computer skills Basic
Stability Stable
Maintained Yes

Publication for iDBPs

iDBPs citations

 (4)
library_books

Vitamin D and Hypertension

2017
PMCID: 5641496
PMID: 29042901
DOI: 10.5049/EBP.2017.15.1.1

[…] specific tissues and cell types to utilize. dbp linked vitamin d is actively transported by megalin mediated endocytosis in the various target cells, and intracellular vitamin d binding proteins (idbps) help to regulate the intracellular metabolism of vitamin d thereafter., the renal production of 1,25 (oh)2d is tightly regulated by 1, 25-dihydroxyvitamin d itself, plasma pth levels […]

library_books

Potential DNA binding and nuclease functions of ComEC domains characterized in silico

2016
PMCID: 5031224
PMID: 27318187
DOI: 10.1002/prot.25088

[…] psi‐blast with an e‐value of 0.0001. the models, along with comparator crystal structures of known function were submitted to the structure‐based nucleic acid binding prediction servers dnabind, and idbps. , b‐form double‐stranded (ds)dna (default sequence ccctgtggagccacaccctag and its complementary strand) was generated at the make‐na server. data‐driven docking on the haddock web server […]

library_books

Expanding the catalog of cas genes with metagenomes

2013
PMCID: 3936711
PMID: 24319142
DOI: 10.1093/nar/gkt1262

[…] a conserved motif that is phenylalanine and tyrosine rich (supplementary figure s8a), and are likely to form helical structures [as predicted by i-tasser ()] and bind dna molecules [as predicted by idbps server ()] (see supplementary figure s8b for a model of the complex structure)., the last example cash6, is found associated with the crispr–cas subtype ic-variant, and shares similar genomic […]

library_books

A Sleeping Beauty DNA transposon based genetic sensor for functional screening of vitamin D3 analogues

2011
PMCID: 3083354
PMID: 21473770
DOI: 10.1186/1472-6750-11-33

[…] d binding protein (dbp). transport across the cellular membrane is mediated by diffusion or megalin-mediated endocytosis prior to binding of the ligand by intracellular vitamin d binding proteins (idbps) within the cytoplasm. upon ligand binding, vdr undergoes a conformational change that allows interaction with other cellular proteins. the vdr-ligand complex is transported across the nuclear […]


Want to access the full list of citations?
iDBPs institution(s)
Department of Biochemistry, The George S Wise Faculty of Life Sciences, Tel Aviv University, Ramat Aviv, Israel

iDBPs reviews

star_border star_border star_border star_border star_border
star star star star star

Be the first to review iDBPs