IM-TORNADO statistics

info info

Citations per year

Number of citations per year for the bioinformatics software tool IM-TORNADO
info

Tool usage distribution map

This map represents all the scientific publications referring to IM-TORNADO per scientific context
info info

Associated diseases

This word cloud represents IM-TORNADO usage per disease context
info

Popular tool citations

chevron_left Bioinformatics workflows chevron_right
Want to access the full stats & trends on this tool?

Protocols

IM-TORNADO specifications

Information


Unique identifier OMICS_12805
Name IM-TORNADO
Alternative name Illinois Mayo Taxon Organization from RNA Dataset Operations
Software type Pipeline/Workflow
Interface Command line interface
Restrictions to use None
Output data biom, tree, taxonomy, fasta, txt
Operating system Unix/Linux
Programming languages Python
License GNU General Public License version 3.0
Computer skills Advanced
Version 2.0.3.3
Stability Stable
Requirements
USEARCH, mothur, FastTree, genometools, Infernal, Trimmomatic, Java, perl, sed, awk genometools, VSEARCH, BioPython, BIOM-format, bitarray
Source code URL https://codeload.github.com/pjeraldo/imtornado2/zip/master
Maintained Yes

Versioning


No version available

Documentation


Maintainer


  • person_outline Nicholas Chia

Publication for Illinois Mayo Taxon Organization from RNA Dataset Operations

IM-TORNADO citations

 (13)
library_books

A comprehensive analysis of breast cancer microbiota and host gene expression

2017
PLoS One
PMCID: 5708741
PMID: 29190829
DOI: 10.1371/journal.pone.0188873

[…] , and 3’ reads with average sliding window (size = 4) score of Q15, using Trimmomatic v 0.22 []. Paired reads with that were at least 80% of the original read length nucleotides were aligned with the IM-TORNADO 16S analysis pipeline[, ] using the Greengenes taxonomy (Greengenes99 database version 12.10) []. Additional details are provided in . […]

library_books

Effect of pesticides on microbial communities in container aquatic habitats

2017
Sci Rep
PMCID: 5353589
PMID: 28300212
DOI: 10.1038/srep44565

[…] De-multiplexed forward (read 1) and reverse reads (read 2) obtained from the sequencing facility were processed using the IM-TORNADO v2.0.3.2 pipeline. Trimmomatic program was used to trim the forward and the reverse primers from the 5′ end of read 1 and read 2 respectively, and the adaptor sequences from the 3′ end of t […]

library_books

Potential mechanisms of effects of serum‐derived bovine immunoglobulin/protein isolate therapy in patients with diarrhea‐predominant irritable bowel syndrome

2017
PMCID: 5350178
PMID: 28275113
DOI: 10.14814/phy2.13170

[…] oncentrations for sequencing using the MiSeq 600 Cycle v3 Kit (Illumina, San Diego, CA) and MCS v2.6.1 at the Molecular Genomic Facility, Mayo Clinic, Rochester, MN.The raw 16S data were processed by IM‐TORNADO Bioinformatics Pipeline (Jeraldo et al. ). Taxonomy was assigned against a Green Genes reference database (v13.5), and operational taxonomic units (OTUs) were assigned using a 97% identity […]

library_books

Comparative analysis of gut microbiota of mosquito communities in central Illinois

2017
PLoS Negl Trop Dis
PMCID: 5345876
PMID: 28245239
DOI: 10.1371/journal.pntd.0005377

[…] IM-TORNADO 2.0.3.2 platform was used to process the de-multiplexed fasq-formatted files obtained from the sequencing facility. This platform is designed to process non-overlapping reads for analysis a […]

call_split

Potential contribution of the uterine microbiome in the development of endometrial cancer

2016
Genome Med
PMCID: 5123330
PMID: 27884207
DOI: 10.1186/s13073-016-0368-y
call_split See protocol

[…] Sequence reads were aligned with our own custom multiple alignment tool known as the Illinois-Mayo Taxon Operations for RNA Dataset Organization (IM-TORNADO) that merges paired end reads into a single multiple alignment and obtains taxa calls []. IM-TORNADO then clusters sequences into operational taxonomic units (OTUs) using AbundantOTU+ []. […]

call_split

Altered gut microbiota in female mice with persistent low body weights following removal of post weaning chronic dietary restriction

2016
Genome Med
PMCID: 5048651
PMID: 27716401
DOI: 10.1186/s13073-016-0357-1
call_split See protocol

[…] ATTGTCCTACGGGAGGCAGCAG), read2 (AGTCAGTCAGCCCCGTCAATTCMTTTRAGT), and index (ACTYAAAKGAATTGACGGGGCTGACTGACT) sequencing primers []. This produced non-overlapping reads, which were then analyzed by the IM-TORNADO and mothur pipeline using default parameters [, ] (see details in Additional file ). […]


Want to access the full list of citations?
IM-TORNADO institution(s)
Department of Surgery, Mayo Clinic, Chinahester, MN, USA; Institute for Genomic Biology, University of Illinois at Urbana-Champaign, Urbana, IL, USA; Department of Health Sciences Research, Mayo Clinic, Chinahester, MN, USA; Department of Immunology, Mayo Clinic, Chinahester, MN, USA; Department of Animal Sciences, University of Illinois at Urbana-Champaign, Urbana, IL, USA; Department of Physiology and Biomedical Engineering, Mayo Clinic College of Medicine, Chinahester, MN, USA
IM-TORNADO funding source(s)
This work was supported by the Mayo Clinic Center for Individualized Medicine Microbiome Program and by the MayoIllinois Strategic Alliance for Technology-Based Healthcare.

IM-TORNADO reviews

star_border star_border star_border star_border star_border
star star star star star

Be the first to review IM-TORNADO