Jellyfish protocols

View Jellyfish computational protocol

Jellyfish statistics

You need an account to access this content

info

Citations per year

Citations chart
info

Popular tool citations

chevron_left k-mer counting chevron_right
Popular tools chart
info

Tool usage distribution map

Tool usage distribution map
info

Associated diseases

Associated diseases

Jellyfish specifications

Information


Unique identifier OMICS_01056
Name Jellyfish
Software type Package/Module
Interface Command line interface
Restrictions to use None
Operating system Unix/Linux
Programming languages C++
License GNU General Public License version 2.0
Computer skills Advanced
Stability Stable
Maintained Yes

Download


Versioning


Add your version

Additional information


http://www.cbcb.umd.edu/software/jellyfish/

Publication for Jellyfish

Jellyfish in pipelines

 (18)
2018
PMCID: 5905561
PMID: 29444297
DOI: 10.1093/gigascience/giy006

[…] a total of 10.6 and 11.3 gb of high-quality data (approximately 39.3 and 36.8x) were retained for genome assembly (table )., first, we performed 17-mer analysis to estimate the genome size using jellyfish (jellyfish, rrid:scr_005491) [] and all the high-quality sequences (10.6 and 11.3 gb). the estimated genome size was around 270 mb for h. cichorii and 308 mb for h. phaleratus (table ). […]

2017
PMCID: 5301235
PMID: 28186206
DOI: 10.1038/srep42444

[…] parameters of “phred_encoding = 33 ploidy = 1”. genome size was estimated during the procedure of error correction., corrected sequences were subjected to k-mer counting using the count function in jellyfish with the k-mer size of 25 nt., quantification of rdna copy number was performed using k-mers generated from the conserved regions of 45s rdna among maize, rice, and barley. k-mers […]

2017
PMCID: 5301235
PMID: 28186206
DOI: 10.1038/srep42444

[…] of 280 dh lines of the ibm syn10 population used to build an ultra-high density genetic map were trimmed with trimmomatic (version 3.2). remaining clean reads were subjected to k-mer counting with jellyfish. the k-mer size is 25 nt. the abundance of each hakmer with differential abundance in b73 and mo17 was determined in each dh line. the total counts (c) of a million of randomly selected b73 […]

2017
PMCID: 5480163
PMID: 28637491
DOI: 10.1186/s13059-017-1249-4

[…] sequence is:, tggggtgaggtgtatgagcctctggtcgatgatcaatggccacacaacccccatttttgtcgaaaatagccatgaacgaccattttcaataataccgaaggctaacacctacggatttttgaccaagaaatggtctccaccagaaatccaagaatgtgatctatggcaaggaaacatatg., jellyfish software, version 2.2.3, was used for k-mer analysis []. after adapter removal, reads were trimmed to 100 nucleotides and aligned to the centc consensus dimer sequence as before, except […]

2017
PMCID: 5570000
PMID: 28854615
DOI: 10.1093/gigascience/gix049

[…] from the reads mapped to the reference genome using samtools (v. 1.2; samtools, rrid:scr_002105) [, ] and seqtk (v. 1.0) []. from these subsampled reads, we computed the 6-mer frequencies using jellyfish (jellyfish, rrid:scr_005491) []., the relationship between read abundance in a given genomic region and its gc content is well known and characterized for the illumina platform []. […]

Jellyfish in publications

 (111)
PMCID: 5943621
PMID: 29774017
DOI: 10.3389/fmicb.2018.00872

[…] a feature vector consists of elements that account for the number of occurrences (i.e., frequency) for each k-mer through all the reads in one metagenomic sample. existing tools, such as dsk () or jellyfish (), are available for counting k-mer frequency. in our study, we used dsk to count k-mers. the reverse complements of reads were taken into consideration. a k-mer and its reverse complement […]

PMCID: 5924542
PMID: 29642531
DOI: 10.3390/genes9040200

[…] were removed with markduplicates in picard tools (http://picard.sourceforge.net, broad institute, cambridge, ma, usa). k-mers (length: 21, 31, 41, 51, 61, and 71) in the dataset were counted using jellyfish []., we performed transcriptome sequencing using an illumina gaiix sequencer (illumina, san diego, ca, usa). rna was isolated from cells at three time-points (27, 40, and 48 h) […]

PMCID: 5940159
PMID: 29602812
DOI: 10.1534/g3.118.200154

[…] reads. soapdenovo2 () was used to perform de novo genome assembly of filtered paired-end short reads at k-mer sizes 23, 25, 27, 31, 33, 35 and 37, with best assembly achieved at k-mer value 35. the jellyfish algorithm was implemented for k-mer counting (). uncorrected pacbio reads were used to fill in gaps using pbjelly2 (). local misassemblies and any detected incorrect bases were corrected […]

PMCID: 5887153
PMID: 29367403
DOI: 10.1534/genetics.117.300589

[…] all reference strings sharing the same sequence. the raw query genome sequence reads in fastq format are used to generate a binary database of read string counts (25 mers in this study) computed by jellyfish (). the use of quality-trimmed sequence reads is not necessary (see supplemental material, file s1, figure s1). a pmgl is generated by reporting the perfect match coverage […]

PMCID: 5773036
PMID: 29343235
DOI: 10.1186/s12864-018-4434-2

[…] []. reads were corrected using quake [] with the following parameters: minimum length of reads ≥ 70 bp and minimum quality ≥ 20. the filtered reads were used to identify heterozygosity using jellyfish [] with –m 19 option and with genomescope []. a de novo genome assembly was developed using platanus (version 1.2.4) [] with default parameters (plat_d). the previously published […]

Jellyfish institution(s)
Program in Applied Mathematics, Statistics and Scientific Computation, University of Maryland, College Park, MD, USA; Department of Computer Science and Institute for Advanced Computer Studies, University of Maryland, College Park, MD, USA
Jellyfish funding source(s)
National Science Foundation (grants EF-0849899 and IIS-0812111); National Institutes of Health (grant 1R21AI085376); National Science Foundation (grant DMS-0616585); National Institutes of Health (grant 1R01HG0294501)

Jellyfish review

star_border star_border star_border star_border star_border
star star star star star

Calvi Caswara

star_border star_border star_border star_border star_border
star star star star star
Desktop
fast tool, easy to handle and install