LinRegPCR statistics

Tool stats & trends

Looking to identify usage trends or leading experts?

Protocols

LinRegPCR specifications

Information


Unique identifier OMICS_33149
Name LinRegPCR
Software type Application/Script
Interface Command line interface
Restrictions to use None
Operating system Unix/Linux
Computer skills Advanced
Stability Stable
Maintained Yes

Download


download.png

Versioning


No version available

Maintainer


  • person_outline Jan Ruijter

Publication for LinRegPCR

LinRegPCR citations

 (689)
library_books

Functional signaling and gene regulatory networks between the oocyte and the surrounding cumulus cells

2018
BMC Genomics
PMCID: 5946446
PMID: 29747587
DOI: 10.1186/s12864-018-4738-2

[…] rs: TGGTGAAGGTCGGAGTGAAC, ATGGCGACGATGTCCACTTT). Primers were designed using Primer-BLAST [] and are described on Additional file : Table S7. The PCR efficiency was estimated for each primer set with LinRegPCR [], and relative expression values were calculated using the method described for primers with different amplification efficiencies []. The results shown in Additional file : Table S7 are ex […]

library_books

Selection and Validation of Reference Genes for Quantitative Real Time PCR Normalization Under Ethanol Stress Conditions in Oenococcus oeni SD 2a

2018
Front Microbiol
PMCID: 5946679
PMID: 29780378
DOI: 10.3389/fmicb.2018.00892

[…] The threshold cycle (Ct) used in this study was automatically calculated by the Bio-Rad IQ5 Optical System software (version 2.1). The amplification efficiency was calculated from the raw data using LinRegPCR software (Ruijter et al., ; Tuomi et al., ). […]

library_books

The Aerobic and Cognitive Exercise Study (ACES) for Community Dwelling Older Adults With or At Risk for Mild Cognitive Impairment (MCI): Neuropsychological, Neurobiological and Neuroimaging Outcomes of a Randomized Clinical Trial

2018
PMCID: 5945889
PMID: 29780318
DOI: 10.3389/fnagi.2018.00076

[…] on Monitor 3 software. All samples and references were run in triplicate and each well contained 20 μL total volume. Raw florescence readings were directly imported into, and baseline corrected with, LinregPCR software package (Version 2016.1). Linear regression was performed on the baseline-corrected data to calculate efficiency using a common window-of-linearity for each primer pair (Ruijter et […]

library_books

An Endophytic Bacterial Consortium modulates multiple strategies to improve Arsenic Phytoremediation Efficacy in Solanum nigrum

2018
Sci Rep
PMCID: 5934359
PMID: 29725058
DOI: 10.1038/s41598-018-25306-x

[…] ΔCt method. Experiments were conducted in three biological replicates (independently isolated RNA), each in triplicates. Primer sequences are listed in Table S. Primer efficiencies were checked using LinRegPCR version 2016. […]

call_split

Pulmonary inflammation induced loss and subsequent recovery of skeletal muscle mass require functional poly ubiquitin conjugation

2018
PMCID: 5932886
PMID: 29720191
DOI: 10.1186/s12931-018-0753-8
call_split See protocol

[…] ech). qPCR primers were designed using Primer Express 2.0 software (applied Biosystems) and ordered from Sigma Genosys (Table ). The relative DNA starting quantities of the samples were derived using LinRegPCR software (Version 2014.0, Ruijter). The expression of genes of interest was normalized to the geometric average of three or four reference genes (cyclophilin A, beta-2-microglobulin, GAPDH, […]

call_split

ODF4, MAGEA3, and MAGEB4: Potential Biomarkers in Patients with Transitional Cell Carcinoma

2018
PMCID: 5889501
DOI: 10.22034/ibj.22.3.160
call_split See protocol

[…] ive relative analysis between different sample groups, raw fluorescence data obtained by Rotor Gene Q series software 2.1.0 were saved as LinReg export format (*.csv) and subsequently loaded into the LinRegPCR software (version 2015.3). The averages of cycle threshold (Ct) values obtained from at least two of each triplicate were input directly in Relative expression software tool (REST©) 2009 (QI […]

Citations

Looking to check out a full list of citations?

LinRegPCR institution(s)
Heart Failure Research Center, Academic Medical Center, University of Amsterdam, The Netherlands; Department of Neuroscience, Faculty of Mental Health, University of Maastricht, The Netherlands; Nestec Ltd, PTC Orbe, Switzerland; Department of Endocrinology and Metabolism, Academic Medical Center, University of Amsterdam, The Netherlands
LinRegPCR funding source(s)
Supported by the Netherlands Heart Foundation (1996M002); European Union FP6 program HeartRepair (LSHMCT-2205-018630).

LinRegPCR reviews

star_border star_border star_border star_border star_border
star star star star star

Be the first to review LinRegPCR