MAGeCK statistics

info info

Citations per year

Number of citations per year for the bioinformatics software tool MAGeCK
info

Tool usage distribution map

This map represents all the scientific publications referring to MAGeCK per scientific context
info info

Associated diseases

info

Popular tool citations

chevron_left Data analysis chevron_right
Want to access the full stats & trends on this tool?

MAGeCK specifications

Information


Unique identifier OMICS_10463
Name MAGeCK
Alternative name Model-based Analysis of Genome-wide CRISPR/Cas9 Knockout
Software type Package/Module
Interface Command line interface
Restrictions to use None
Operating system Unix/Linux
Programming languages C, Python
License BSD 2-clause “Simplified” License
Computer skills Advanced
Version 0.5.7
Stability Stable
Maintained Yes

Download


download.png
sourceforge.png
conda.png

Versioning


No version available

Documentation


Maintainers


  • person_outline Wei Li
  • person_outline Liu Shirley

Additional information


https://sourceforge.net/p/mageck/wiki/Home/ https://www.youtube.com/watch?v=iIyP2w44ric

Publications for Model-based Analysis of Genome-wide CRISPR/Cas9 Knockout

MAGeCK citations

 (20)
library_books

STAG2 deficiency induces interferon responses via cGAS STING pathway and restricts virus infection

2018
Nat Commun
PMCID: 5902600
PMID: 29662124
DOI: 10.1038/s41467-018-03782-z

[…] ltiple rounds of infection until the appearance of visibly apparent survival colonies, which were then harvested and processed for next-generation sequencing (Fig. ). Ranking the enriched genes using MAGeCK algorithm revealed a large panel of novel host-dependency factors for RV infection (Fig. ). Using this screening strategy, consistent with published studies,,, we identified several genes known […]

library_books

Genome wide CRISPR/Cas9 Screen Identifies Host Factors Essential for Influenza Virus Replication

2018
Cell Rep
PMCID: 5939577
PMID: 29642015
DOI: 10.1016/j.celrep.2018.03.045

[…] s (≥10 reads) representing ~1% of the sgRNAs present in the A549-GeCKO library (). Next, candidate genes were identified and ranked using the model-based analysis of genome-wide CRISPR/Cas9 knockout (MAGeCK) program (). We observed positive selection of 119 genes in Prelim Rd5 (p < 0.1), with the SLC35A1 gene (sialic acid transporter) ranked highest and demonstrating representation by all 3 indepe […]

library_books

A CRISPR screen for factors regulating SAMHD1 degradation identifies IFITMs as potent inhibitors of lentiviral particle delivery

2018
Retrovirology
PMCID: 5859395
PMID: 29554922
DOI: 10.1186/s12977-018-0409-2

[…] sgRNA enrichment was analyzed using the Bioconductor package edgeR [] and gene-level analysis was performed using MAGeCK []. The IFNα induction data was generated using a dataset (GSE46599) published by Goujon et al. [] and re-analyzed using the lumi [] and limma [] Bioconductor packages. When several probes were […]

library_books

MARCH6 and TRC8 facilitate the quality control of cytosolic and tail‐anchored proteins

2018
EMBO Rep
PMCID: 5934766
PMID: 29519897
DOI: 10.15252/embr.201745603

[…] Qiagen) according to the manufacturer's instructions, and DNA was amplified using two rounds of PCR as previously described . DNA was sequenced by Illumina HiSeq as described , and analysed using the MAGeCK algorithm .SgRNA amplification primers (5′–3′): Outer_Fwd GCTTACCGTAACTTGAAAGTATTTCG,Outer_Rev GTCTGTTGCTATTATGTCTACTATTCTTTCC,P5_inner_Fwd AATGATACGGCGACCACCGAGATCTACACTCTCTTGTGGAAAGGACGAAACAC […]

library_books

ASC and caspase 8 dependent apoptotic pathway diverges from the NLRC4 inflammasome in macrophages

2018
Sci Rep
PMCID: 5830643
PMID: 29491424
DOI: 10.1038/s41598-018-21998-3

[…] solation was performed using Puregene reagents (Qiagen). Next generation sequencing was performed on MiSeq system (Illumina) with 50 million sequences reads per sample. Screen hits were identified by MAGeCK computational analyses for sgRNA enrichment in flagellin compared to control treatment. Raw counts were filtered to remove low abundance guides using heuristic from the gCrisprTools package tha […]

library_books

CRISPR–Cas9 Genetic Analysis of Virus–Host Interactions

2018
Viruses
PMCID: 5850362
PMID: 29385696
DOI: 10.3390/v10020055

[…] ng []. We typically use target cell libraries with an average of 500 cells per sgRNA, resulting in ~40 million cells for a library with 4 sgRNAs against each human gene [].Algorithms such as STARS or MAGeCK are used to identify statistically significant hits from the deep sequencing data [,,,], typically by comparing input versus selected cell populations. STARS and MAGeCK identify robust hits, fo […]


Want to access the full list of citations?
MAGeCK institution(s)
Center for Functional Cancer Epigenetics, Dana-Farber Cancer Institute, Boston, MA, USA; Department of Biostatistics and Computational Biology, Dana-Farber Cancer Institute, and Harvard School of Public Health, Boston, MA, USA; Biological and Biomedical Science Program, Harvard Medical School, Boston, MA, USA; Department of Medical Oncology, Dana-Farber Cancer Institute, and Harvard Medical School, Boston, MA, USA; Center for Genetic Medicine Research, Children's National Health System, Washington, DC, USA; Department of Genomics and Precision Medicine, The George Washington School of Medicine and Health Sciences, Washington, DC, USA; Department of Epigenetics and Molecular Carcinogenesis, The University of Texas MD Anderson Cancer Center, Smithville, TX, USA
MAGeCK funding source(s)
Supported by the National Institutes of Health [HG008727, HG008927].

MAGeCK reviews

star_border star_border star_border star_border star_border
star star star star star

Be the first to review MAGeCK