MIPModDB specifications

Information


Unique identifier OMICS_07199
Name MIPModDB
Restrictions to use None
Maintained Yes
Wikipedia https://en.wikipedia.org/wiki/MIPModDB

Publication for MIPModDB

MIPModDB citations

 (2)
library_books

Functional characterization of an aquaporin from a microsporidium, Nosema bombycis

2017
PLoS One
PMCID: 5531513
PMID: 28749993
DOI: 10.1371/journal.pone.0181703

[…] The NbAQP gene in N. bombycis was identified using the MicrosporidiaDB (http://microsporidiadb.org/micro/) and MIPModDB (http://bioinfo.iitk.ac.in/MIPModDB/index.html) databases. The following PCR primers were designed based on homologous gene sequences: upstream primer, 5’- ATGACCAGAGAGACATTGAAG -3’ and downs […]

library_books

New subfamilies of major intrinsic proteins in fungi suggest novel transport properties in fungal channels: implications for the host fungal interactions

2014
BMC Evol Biol
PMCID: 4236510
PMID: 25112373
DOI: 10.1186/s12862-014-0173-4

[…] ified two additional AQGP subgroups in our analysis (Figure b). Sequences, structural models and other associated details of all 395 sequences from 172 different fungal organisms are available in our MIPModDB database (http://bioinfo.iitk.ac.in/MIPModDB) []. The accession codes of these sequences from GenBank or JGI are provided in the Additional file : Table S1. […]

MIPModDB institution(s)
Department of Biological Sciences and Bioengineering, Indian Institute of Technology Kanpur, Kanpur, India

MIPModDB reviews

star_border star_border star_border star_border star_border
star star star star star

Be the first to review MIPModDB