mothur protocols

View mothur computational protocol

mothur statistics

To access cutting-edge analytics on consensus tools, life science contexts and associated fields, you will need to subscribe to our premium service.

Subscribe
info

Citations per year

Citations chart
info

Popular tool citations

chevron_left Read alignment Multiple nucleotide sequence alignment Bioinformatics workflows Prediction-based taxonomic classification Chimera detection Denoising chevron_right
Popular tools chart
info

Tool usage distribution map

Tool usage distribution map
info

Associated diseases

Associated diseases

mothur specifications

Information


Unique identifier OMICS_01518
Name mothur
Software type Package/Module
Interface Command line interface
Restrictions to use None
Operating system Unix/Linux
Programming languages C++
Computer skills Advanced
Version 1.38.0
Stability Stable
Maintained Yes
Wikipedia https://en.wikipedia.org/wiki/Mothur

Download


Versioning


Add your version

Documentation


Publication for mothur

mothur in pipelines

 (313)
2018
PMCID: 5765012
PMID: 29323168
DOI: 10.1038/s41598-017-18777-x

[…] assembled using pandaseq software. this approach has been shown to reduce the substitution error rates by ~93% in illumina miseq sequence data. further sequence processing steps were performed on mothur pipeline. the assembled sequences were aligned against a silva alignment (http://www.arb-silva.de/), and subsequently denoised using ‘pre.cluster’ command implemented in mothur. chimeric […]

2018
PMCID: 5767322
PMID: 29375610
DOI: 10.3389/fpls.2017.02241

[…] interface. several other tools are available: uparse (edgar, ) aims to detect de novo otus from ngs reads achieving high accuracy in biological sequence recovery, and improving richness estimate; mothur (schloss et al., ) is a comprehensive software package, which analyzes community sequencing data; dada2 (callahan et al., ) is a model-based approach to correct amplicon errors without […]

2018
PMCID: 5785724
PMID: 29403454
DOI: 10.3389/fmicb.2017.02709

[…] (across the whole dataset) relative abundance of ≥0.1% were considered., a phylogenetic tree was built with the 175 otus displaying a mean relative abundance of ≥0.1%. the tree was constructed using mothur, and visualized using the online tool itol version 3.2.4 (letunic and bork, )., standard dna for vibrio-targeting qpcr originated from an in house culture of v. aestuarianus and was extracted […]

2018
PMCID: 5792453
PMID: 29386588
DOI: 10.1038/s41598-018-19860-7

[…] (jaccard) or abundance (thetayc). phylotype diversity was determined using ‘phylo.diversity’ script after a phylogenetic tree was constructed for representative otus using ‘clearcut’ script within mothur. the generated phylogeny inference package-formatted distance matrix, based on jaccard and thetayc values, was used for pcoa and nmds to determine microbial community differences in honey bees […]

2018
PMCID: 5808307
PMID: 29467752
DOI: 10.3389/fmicb.2018.00169

[…] base ‘n,’ and average base quality score < 20) were removed using qiime pipeline version 1.8.0 () before further analysis. potential chimeras were discarded using the ‘chimera.uchime’ command in mothur (), using both no external database and the maarjam 18s rrna gene reference database (). the remaining non-chimeric sequences were clustered into different operational taxonomic units (otus) […]


To access a full list of citations, you will need to upgrade to our premium service.

mothur in publications

 (2283)
PMCID: 5955947
PMID: 29769540
DOI: 10.1038/s41598-018-24974-z

[…] modified mcra 1360 r primer (5′-3′):, gtctcgtgggctcggagatgtgtataagagacagtgcctctttgtggaggtacatgga., the sequencing data were analysed using the mothur (version 1.33.2) according to the standard operating procedure,. briefly, the sequences were sorted into different samples by matching the specific barcodes. then, the primers, barcodes, […]

PMCID: 5952520
PMID: 29764472
DOI: 10.1186/s13071-018-2880-y

[…] taken to indicate suboptimal pcr amplification., individual larvae were picked, lysed, pcr amplified and sequenced as previously described in avramenko et al. []., samples were analyzed using the mothur bioinformatic tool version 1.36.1 []. raw pair-end reads were assembled creating single contigs. reads were filtered and removed if they were < 200 bp or > 450 bp […]

PMCID: 5948730
PMID: 29753324
DOI: 10.1186/s40168-018-0477-5

[…] under the sra study srp133552., prior to metagenomic analysis, sequence reads with a quality score mean below 30 were removed using prinseq []. the 16s rrna sequence analysis was performed using mothur v. 1.39 []. analysis was performed as according to the miseq sop (accessed online 28/06/2017; []). the 16s rrna gene sequences were aligned against a reference alignment based on the silva […]

PMCID: 5942802
PMID: 29742123
DOI: 10.1371/journal.pone.0196178

[…] of 250 bp. for data analysis, the forward and reverse fastq files were concatenated, filtered by read quality (phred score) and the barcodes and primers sequences were eliminated using qiime [] and mothur []. the final length of v4 sequences was ∼252 bp. for quality filtering, qiime default parameters were used, with a minimun phred quality score <20 and ambiguous nucleotides were removed. […]

PMCID: 5940813
PMID: 29740156
DOI: 10.1038/s41598-018-25636-w

[…] microbiome database with confidence threshold of 70%. alpha diversity indices (shannon index, simpson index) and richness estimators (ace index and chao 1 index) calculations were performed using mothur v.1.30.2. phylogenetic beta diversity measures such as the unweighted unifrac distance metrics analysis was determined using the represent sequences of otus for each sample, and principal […]


To access a full list of publications, you will need to upgrade to our premium service.

mothur institution(s)
Department of Microbiology, University of Massachusetts, Amherst, MA, USA; Department of Microbiology and Immunology, University of Michigan, Ann Arbor, MI, USA; Department of Biology, University of New Mexico, Albuquerque, NM, USA; Department of Microbiology and Immunology, University of British Columbia, Vancouver, BC, Canada; Department of Soil and Crop Sciences, Texas A&M University, College Station, TX, USA; Department of Soil, Water, and Climate, University of Minnesota, St. Paul, MN, USA; Department of Biological Sciences, University of Warwick, Coventry, UK; Faculty of Computer Science, Dalhousie University, Halifax, NS, Canada; Environmental Science and Engineering, Colorado School of Mines, Golden, CO; Department of Animal Science, University of Ljubljana, Ljubljana, Slovenia; Institute for Genomics and Bioinformatics, Graz University of Technology, Graz, Austria; Department of Biological Sciences, Louisiana State University, Baton Rouge, LA, USA
mothur funding source(s)
Funding for mothur has been provided by the College of Natural Resources and the Environment at the University of Massachusetts, a grant from the Sloan Foundation, a grant from the National Science Foundation (award 0743432), and the Austrian GEN-AU project BIN.

mothur reviews

star_border star_border star_border star_border star_border
star star star star star

Be the first to review mothur