peakC statistics

Tool stats & trends

Looking to identify usage trends or leading experts?

peakC specifications

Information


Unique identifier OMICS_29673
Name peakC
Software type Package/Module
Interface Command line interface
Restrictions to use None
Input data Some CaptureC data and o PCHiC data.
Operating system Unix/Linux, Mac OS, Windows
Programming languages R
Computer skills Advanced
Stability Stable
Maintained Yes

Download


download.png

Versioning


No version available

Documentation


Maintainer


  • person_outline Elzo de Wit

Publication for peakC

peakC citations

 (6)
library_books

A theory of how active behavior stabilises neural activity: Neural gain modulation by closed loop environmental feedback

2018
PLoS Comput Biol
PMCID: 5809098
PMID: 29342146
DOI: 10.1371/journal.pcbi.1005926

[…] loop feedback signal to the brain. The presence of this feedback changes the effective time constant to τeff = τ/(1−wτ). The magnitude of the fluctuations is now characterized by autocorrelation peak Peakc = Peako/(1−wτ) and the effective gain of the system is Gainc = Gaino/(1−wτ). In particular, if this feedback is negative (w < 0), it will suppress both fluctuations and the gain of sensory respo […]

library_books

Integration of human pancreatic islet genomic data refines regulatory mechanisms at Type 2 Diabetes susceptibility loci

2018
eLife
PMCID: 5828664
PMID: 29412141
DOI: 10.7554/eLife.31977.047

[…] normalized to the total number of cis interactions (i.e. same chromosome) per 100,000 interactions. Significant chromatin interactions were determined from a rank-sum test implemented in the program peakC ()(https://github.com/deWitLab/peakC). Specifically, we evaluated interactions involving all SNPs in high LD (r2 >0.8) with the lead rs11708067. The lead variant (rs11708067) was in high LD with […]

library_books

CTCF orchestrates the germinal centre transcriptional program and prevents premature plasma cell differentiation

2017
Nat Commun
PMCID: 5504274
PMID: 28677680
DOI: 10.1038/ncomms16067

[…] A (forward) 5′-GGGGTTGTAGGTCCACCTGT-3′; Prdm1-PeakA (reverse) 5′- CTGGCACAAGAGCAAGCTAA -3′; Prdm1-PeakB (forward) 5′- ACTGGAGGGCCGAGTGTC -3′; Prdm1-PeakB (reverse) 5′- GGGAGGGGGAAGAGTAGTCA -3′; Prdm1-PeakC (forward) 5′- GACACCAAGAGGGACCAGAG-3′; Prdm1-PeakC (reverse) 5′-AACTTCCCCGAAGGCTAGAG -3′; H19-Peak1 (forward) 5′- GTCACTCAGGCATAGCATTC-3′; H19-Peak1 (reverse) 5′- GTCTGCCGAGCAATATGTAG-3′; H19-Pe […]

library_books

The Cohesin Release Factor WAPL Restricts Chromatin Loop Extension

2017
Cell
PMCID: 5422210
PMID: 28475897
DOI: 10.1016/j.cell.2017.04.013

[…] y probably do not represent ligation events. Non-unique fragments and fragments created by the digestion of two DpnII sites (“blind” fragments) were also filtered out.Peak calling was performed using peakC (https://github.com/deWitLab/peakC). The main assumption in our 4C analysis is that the contact frequency decreases monotonically with the distance. We use monotonic regression to model the back […]

library_books

Effects of season and age at first calving on genetic and phenotypic characteristics of lactation curve parameters in Holstein cows

2016
PMCID: 4761201
PMID: 26900481
DOI: 10.1186/s40781-016-0089-1

[…] rves. The Wood mathematical model was as follow:Yt=atbe‐ctWheret = days in milkYt = milk yield in kga = approximates the initial milk yields after calvingb = the inclining slope parameter up to yield peakc = the declining slope parameterThe days at peak milk yield, Peak milk yield, and total milk of 305-d were calculated as b/c, a(b/c)bexp‐ b and ∑i=5305atbexp‐ct respectively. Moreover, partial pr […]

library_books

Applying Microsatellite Multiplex PCR Analysis (MMPA) for Determining Allele Copy Number Status and Percentage of Normal Cells within Tumors

2012
PLoS One
PMCID: 3419736
PMID: 22916147
DOI: 10.1371/journal.pone.0042682

[…] exp) in which there is no AI for that microsatellite marker. Peakexp in the tumor is calculated by multiplying Kμ by the allele peak height value of the relative microsatellite in the control sample (peakC)():Allele peak heights of a microsatellite with AI will depend on the number of copies of that allele in AI-cells and the percentage of AI-cells within the tumor. Depending on the mechanism gene […]

Citations

Looking to check out a full list of citations?

peakC institution(s)
Oncode Institute, Hubrecht Institute-KNAW & University Medical Center Utrecht, Utrecht, the Netherlands; Oncode Institute and Division of Gene Regulation, the Netherlands Cancer Institute, Amsterdam, the Netherlands
peakC funding source(s)
Supported by European Research Council (ERC) [StG 637587 HAPPHEN]; Netherlands Organisation for Scientific Research (NWO) [NWO-VICI 724.012.003]; and Oncode Institute which is partly financed by the Dutch Cancer Society.

peakC reviews

star_border star_border star_border star_border star_border
star star star star star

Be the first to review peakC