PolyMarker statistics

Tool stats & trends

Looking to identify usage trends or leading experts?

PolyMarker specifications

Information


Unique identifier OMICS_07462
Name PolyMarker
Software type Pipeline/Workflow
Interface Command line interface
Restrictions to use None
Operating system Unix/Linux
Programming languages Ruby
Computer skills Advanced
Stability Stable
Maintained Yes

Versioning


No version available

Maintainer


  • person_outline Ricardo H. Ramirez-Gonzalez

Information


Unique identifier OMICS_07462
Name PolyMarker
Interface Web user interface
Restrictions to use None
Programming languages Ruby
Computer skills Basic
Stability Stable
Maintained Yes

Maintainer


  • person_outline Ricardo H. Ramirez-Gonzalez

Publication for PolyMarker

PolyMarker citations

 (11)
library_books

Predicting clinical diagnosis in Huntington's disease: An imaging polymarker

2018
PMCID: 5900832
PMID: 29405351
DOI: 10.1002/ana.25171

[…] sing SVMs and permutation testing (see Materials and Methods).We first classified the preHD and controls based on either their RSN coupling strengths, SCVs, or the CTs independently, or combined as a polymarker (Table , row 1). The SVMs performed significantly higher than chance for each feature set (Rest: F1 = 67%; p < 0.02; CT: F1 = 65%; p < 0.02; SCVs: F1 = 72%; p < 0.02; polymarker: F1 = 74%; […]

library_books

Genetic Dissection of End Use Quality Traits in Adapted Soft White Winter Wheat

2018
Front Plant Sci
PMCID: 5861628
PMID: 29593752
DOI: 10.3389/fpls.2018.00271

[…] ial to exploit transgressive segregation, pyramid desirable alleles, and ensure potential genetic gains in succeeding generations. KASP markers of the reported MTAs are commercially available (http://polymarker.tgac.ac.uk/), making it easier to test and determine the value of these MTAs in different breeding programs. Typically, end-use quality assessment is conducted later in the breeding cycle b […]

library_books

Population structure of the ash dieback pathogen, Hymenoscyphus fraxineus, in relation to its mode of arrival in the UK

2017
PMCID: 5832303
PMID: 29527064
DOI: 10.1111/ppa.12762

[…] Primers for SNP detection by Kompetitive Allele Specific PCR (KASP; LGC Genomics) were designed using polymarker (Ramirez‐Gonzalez et al., ). For each locus, a common primer and two allele‐specific primers were used with either a 5′‐HEX‐GAAGGTCGGAGTCAACGGATT‐3′ or 5′‐FAM‐GAAGGTGACCAAGTTCATGCT‐3′ adapt […]

library_books

Domain general subregions of the medial prefrontal cortex contribute to recovery of language after stroke

2017
PMCID: 5903407
PMID: 29177494
DOI: 10.1093/brain/awx134

[…] on the early language measure) and of age. These were selected to be the most significant confounding factors amongst a number of potential demographic, and stroke-related factors. Suggesting that a polymarker that is based on all three measures could potentially provide a subacute phase tool for approximating the subsequent recovery.Third, we examined a different longitudinal time window to the […]

library_books

The eyespot resistance genes Pch1 and Pch2 of wheat are not homoeoloci

2016
PMCID: 5214848
PMID: 27665367
DOI: 10.1007/s00122-016-2796-x

[…] set of SNPs mapping to 7A and polymorphic between the two parental lines CS and Cappelle Desprez, a set of SNPs located across the Pch2 region interval was selected. KASP primers were designed using PolyMarker, an automated bioinformatics pipeline for SNP assay development which is designed to increase the probability of generating homoeologue-specific assays for polyploid wheat [http://polymarke […]

library_books

Highlights of the 2 nd Bioinformatics Student Symposium by ISCB RSG UK

2016
F1000Res
PMCID: 4870987
PMID: 27239284
DOI: 10.12688/f1000research.8445.1

[…] Innes Centre, UK, informed us of his work on the next-generation sequencing of wheat to identify single nucleotide polymorphisms (SNP) associated with yellow stripe rust resistance. He also described PolyMarker, a tool which can assist with designing primers for SNP assays in polyploid plant species. […]

Citations

Looking to check out a full list of citations?

PolyMarker institution(s)
The Genome Analysis Centre (TGAC), Norwich Research Park, Norwich, UK

PolyMarker reviews

star_border star_border star_border star_border star_border
star star star star star

Be the first to review PolyMarker