PRANK statistics

info info

Citations per year

Number of citations per year for the bioinformatics software tool PRANK
info

Tool usage distribution map

This map represents all the scientific publications referring to PRANK per scientific context
info info

Associated diseases

This word cloud represents PRANK usage per disease context
info

Popular tool citations

chevron_left Multiple nucleotide sequence alignment Multiple amino acid sequence alignment chevron_right
Want to access the full stats & trends on this tool?

Protocols

PRANK specifications

Information


Unique identifier OMICS_12425
Name PRANK
Alternative name webPRANK
Software type Package/Module
Interface Command line interface
Restrictions to use None
Input format Fasta
Output format Fasta
Operating system Unix/Linux, Mac OS, Windows
Computer skills Advanced
Stability Stable
Maintained Yes

Download


download.png
debian.png
conda.png

Versioning


No version available

Maintainers


  • person_outline Ari Löytynoja
  • person_outline webPRANK

Additional information


A web interface is available at: https://www.ebi.ac.uk/goldman-srv/webprank/

Information


Unique identifier OMICS_12425
Name PRANK
Alternative name webPRANK
Interface Web user interface
Restrictions to use None
Input data DNA sequences, protein sequences.
Input format FASTA
Programming languages C++
License GNU General Public License version 3.0
Computer skills Basic
Stability Stable
Maintained Yes

Maintainers


  • person_outline Ari Löytynoja
  • person_outline webPRANK

Additional information


A web interface is available at: https://www.ebi.ac.uk/goldman-srv/webprank/

Publications for PRANK

PRANK citations

 (98)
library_books

Unifying the global phylogeny and environmental distribution of ammonia oxidising archaea based on amoA genes

2018
Nat Commun
PMCID: 5904100
PMID: 29666365
DOI: 10.1038/s41467-018-03861-1

[…] eins, sequences of each subunit were separately aligned with 14 different methods: L-INS-i, E-INS-i and G-INS-i strategies of MAFFT v7; PSI-Coffee, EXPRESSO; T-Coffee; ProbCons v1.12; Probalign v1.3; Prank; Muscle v3.7; MSAProbs v0.9.7; Kalign; Dialign-TX; and Clustal Omega. The 10 best alignments were selected after evaluation with MUMSA based on multiple overlap (MOS) and average overlap (AOS) s […]

library_books

Assembly of the Boechera retrofracta Genome and Evolutionary Analysis of Apomixis Associated Genes

2018
Genes
PMCID: 5924527
PMID: 29597328
DOI: 10.3390/genes9040185

[…] The evolutionary history of APOLLO gene was inferred by using the Maximum Likelihood method. Initial alignment of corresponding CDS was performed using prank v.140110 [] in codon-aware mode. The alignment result was further used for building phylogenetic tree basing on the Tamura-Nei model [,]. The tree with the highest log likelihood (−12,153.79) wa […]

call_split

Molecular basis of an agarose metabolic pathway acquired by a human intestinal symbiont

2018
Nat Commun
PMCID: 5849685
PMID: 29535379
DOI: 10.1038/s41467-018-03366-x
call_split See protocol

[…] 2_AgRev3 (TCAACTATTGGTGGTTGCGTTGTCCTAACA) and sequenced. To determine the exact site of insertion, 50 kbp upstream and downstream of the insertion site in Bu ATCC 8492 and Bu NP1 was determined using webPRANK via EMBL. Regions adjacent to expected insertion sites were then extracted from this sequence data and the 50 kbp regions were aligned. […]

call_split

The FBH family of bHLH transcription factors controls ACC synthase expression in sugarcane

2018
J Exp Bot
PMCID: 5920332
PMID: 29514290
DOI: 10.1093/jxb/ery083
call_split See protocol

[…] um (Sorghum bicolor), maize (Zea mays), foxtail millet (Setaria italica), and switchgrass (Panicum virgatum) databases available on Phytozome (www.phytozome.net) and performed the alignment using the WebPRANK global alignment tool () with default parameters. Arabidopsis and tomato ACS were included to guide the classification of subgroups ( at JXB online). The phylogenetic tree was constructed in […]

call_split

Polymorphism in Mitochondrial Group I Introns among Cryptococcus neoformans and Cryptococcus gattii Genotypes and Its Association with Drug Susceptibility

2018
Front Microbiol
PMCID: 5808193
PMID: 29467729
DOI: 10.3389/fmicb.2018.00086
call_split See protocol

[…] the manufacturer's instructions and sequenced at MACROGEN/South Korea. All the sequences were aligned together with reference sequences (NCBI accession numbers AY560611, DQ479323, and AY560612) using PRANK online (EMBL-EBI) (http://www.ebi.ac.uk/goldman-srv/webPRANK/) (Löytynoja and Goldman, ). A search for homing endonuclease genes (HEG) was carried out for each sequenced intron using the Conserv […]

library_books

Arms race of temporal partitioning between carnivorous and herbivorous mammals

2018
Sci Rep
PMCID: 5789060
PMID: 29379083
DOI: 10.1038/s41598-018-20098-6

[…] d from GenBank (Supplementary Table ). For each gene, the longest transcript variant was used when multiple transcript variants were available. We aligned the gene sequences using the online software webPRANK (http://www.ebi.ac.uk/goldman-srv/webprank/), which is believed to reduce false-positive results of positive selection analyses by generating a more reliable alignment than other software. Th […]


Want to access the full list of citations?
PRANK institution(s)
Institute of Biotechnology, University of Helsinki, Helsinki, Finland

PRANK reviews

star_border star_border star_border star_border star_border
star star star star star

Be the first to review PRANK