Primer-BLAST statistics

info info

Citations per year

Number of citations per year for the bioinformatics software tool Primer-BLAST
info

Tool usage distribution map

This map represents all the scientific publications referring to Primer-BLAST per scientific context
info info

Associated diseases

This word cloud represents Primer-BLAST usage per disease context
info

Popular tool citations

chevron_left Conventional primer design chevron_right
Want to access the full stats & trends on this tool?

Protocols

Primer-BLAST specifications

Information


Unique identifier OMICS_02343
Name Primer-BLAST
Interface Web user interface
Restrictions to use None
Input data Accession, gi, or sequence
Input format FASTA
Programming languages C++
Computer skills Basic
Stability Stable
Maintained Yes

Maintainer


  • person_outline Jian Ye

Publication for Primer-BLAST

Primer-BLAST citations

 (2536)
call_split

Elucidating the genetic architecture of reproductive ageing in the Japanese population

2018
Nat Commun
PMCID: 5958096
PMID: 29773799
DOI: 10.1038/s41467-018-04398-z
call_split See protocol

[…] ing the SYBR GreenER™ qPCR SuperMix system (Invitrogen, Carlsbad, CA). Suitable amplification primers were designed using the PrimerSelect tool of DNASTAR 14 software (Madison, WI) or the NCBI online Primer-Blast program (Supplementary Table ). PCR reactions were performed in a volume of 10 μl containing 1 μl of diluted cDNA, 5 μl of SYBR GreenER™ qPCR SuperMix and 4 μl of primers mix (1 µM of eac […]

library_books

Different clusters of Candidatus ‘Methanoperedens nitroreducens’ like archaea as revealed by high throughput sequencing with new primers

2018
Sci Rep
PMCID: 5955947
PMID: 29769540
DOI: 10.1038/s41598-018-24974-z

[…] hen carried out using Primer Premier (version 6.0, Premier Biosoft International, USA). The McrA 997 F primer was newly designed in this study and the efficiency was confirmed in silico with the NCBI Primer-Blast tool.Figure 4 […]

library_books

Adverse effects of Hif1a mutation and maternal diabetes on the offspring heart

2018
PMCID: 5948854
PMID: 29753320
DOI: 10.1186/s12933-018-0713-0

[…] relative expression of a target gene was calculated, based on qPCR efficiencies and the quantification cycle (Cq) difference (Δ) of an experimental sample versus control. Primers were designed using Primer Blast tool (https://www.ncbi.nlm.nih.gov/tools/primer-blast/). Primers were selected according to the following parameters: length between 18 and 24 bases, melting temperature (Tm) between 58° […]

library_books

Role of FGFR2b expression and signaling in keratinocyte differentiation: sequential involvement of PKCδ and PKCα

2018
PMCID: 5948219
PMID: 29752438
DOI: 10.1038/s41419-018-0509-x

[…] Oligonucleotide primers necessary for target genes and the housekeeping gene were chosen utilizing the online tool Primer-BLAST and purchased from Invitrogen. Primers list and characteristics are reported in Supplementary Table . For p63 target gene, the reported primers were designed to recognize both ΔNp63 and T […]

library_books

An overview of technical considerations when using quantitative real time PCR analysis of gene expression in human exercise research

2018
PLoS One
PMCID: 5944930
PMID: 29746477
DOI: 10.1371/journal.pone.0196438

[…] qPCR was performed with a QuantStudio 7 Flex (Applied Biosystems, Foster City, CA). Primers were either adapted from existing literature or designed using Primer-BLAST (http://www.ncbi.nlm.nih.gov/tools/primer-blast/) to include all splice variants, and were purchased from Sigma-Aldrich. Detailed information and instructions for using Primer-BLAST have […]

library_books

Functional signaling and gene regulatory networks between the oocyte and the surrounding cumulus cells

2018
BMC Genomics
PMCID: 5946446
PMID: 29747587
DOI: 10.1186/s12864-018-4738-2

[…] de 3-phosphate dehydrogenase (GAPDH) gene as the internal control to normalize the expression levels of target genes (primers: TGGTGAAGGTCGGAGTGAAC, ATGGCGACGATGTCCACTTT). Primers were designed using Primer-BLAST [] and are described on Additional file : Table S7. The PCR efficiency was estimated for each primer set with LinRegPCR [], and relative expression values were calculated using the method […]


Want to access the full list of citations?
Primer-BLAST institution(s)
National Center for Biotechnology Information, National Library of Medicine, National Institutes of Health, Bethesda, MD, USA; Neuroscience and Behavioral Disorders Program, Duke-NUS Graduate Medical School, Singapore, Singapore
Primer-BLAST funding source(s)
Supported by the Intramural Research Program of the NIH, National Library of Medicine, the Singapore Ministry of Health and the Agency for Science, Technology, and Research.

Primer-BLAST reviews

star_border star_border star_border star_border star_border
star star star star star

Be the first to review Primer-BLAST