Primer-BLAST protocols

View Primer-BLAST computational protocol

Primer-BLAST statistics

To access cutting-edge analytics on consensus tools, life science contexts and associated fields, you will need to subscribe to our premium service.

Subscribe
info

Citations per year

Citations chart
info

Popular tool citations

chevron_left Conventional primer design chevron_right
Popular tools chart
info

Tool usage distribution map

Tool usage distribution map
info

Associated diseases

Associated diseases

Primer-BLAST specifications

Information


Unique identifier OMICS_02343
Name Primer-BLAST
Interface Web user interface
Restrictions to use None
Input data Accession, gi, or sequence
Input format FASTA
Programming languages C++
Computer skills Basic
Stability Stable
Maintained Yes

Maintainer


  • person_outline Jian Ye <>

Publication for Primer-BLAST

Primer-BLAST in pipelines

 (67)
2018
PMCID: 5772385
PMID: 29362695
DOI: 10.7717/peerj.4261

[…] argets were selected based on annotations related to gene regulation, immune response, and growth (). corresponding contigs were then selected from the transcriptome using the seqinr package (). ncbi primer blast was used to develop primers for qpcr using the following parameters: amplicon size 100–400 bp, gc content 55–60%, melt temperatures ∼60 °c and within 0.5 °c of each other, self and 3′ com […]

2018
PMCID: 5780484
PMID: 29362405
DOI: 10.1038/s41598-018-19950-6

[…] for qpcr, using prime script tm rt reagent kit with gdna eraser (takara, dalian, china). specific primers for qpcr were designed using premier primer 5 (supplementary table ) and verified by ncbi primer-blast. elongation factor was used as an endogenous control. the amplification was performed on the lightcycler 480 real-time pcr instrument (roche diagnostics, burgess hill, uk) using sybr® […]

2018
PMCID: 5797622
PMID: 29441079
DOI: 10.3389/fpls.2018.00044

[…] max v2.0). indels in the rpszs18 mapping region were identified between the parental cultivars williams and zaoshu18. pcr-based indel markers were developed in the mapping region of rpszs18 using primer-blast (https://www.ncbi.nlm.nih.gov/tools/primer-blast/). f2:3 families and parental cultivars were genotyped based on the indel markers. pcr reactions were conducted as described […]

2018
PMCID: 5807760
PMID: 29426343
DOI: 10.1186/s12989-018-0244-6

[…] bioinformatics tool, primer bank (https://pga.mgh.harvard.edu/primerbank/index.html) [–]. the primers were further justified in the ncbi primer designing tool (https://www.ncbi.nlm.nih.gov/tools/primer-blast/) ye et al., []. the forward and reverse primers of the corresponding gene were listed in table .table 1, for the validation assay, we performed four replicates (n = 4). the exposures […]

2018
PMCID: 5841425
PMID: 29515101
DOI: 10.1038/s41419-018-0421-4

[…] pcr system (applied biosystems, foster city, ca, usa). relative quantification was based on the δδct method, and rplp0 gene was used as a reference control. pcr primers were designed using ncbi primer-blast., rna sequencing libraries were prepared using the illumina truseq sample preparation kit and sequenced on a hiseq 2000 system (illumina, san diego, ca, usa), according […]


To access a full list of citations, you will need to upgrade to our premium service.

Primer-BLAST in publications

 (2276)
PMCID: 5958096
PMID: 29773799
DOI: 10.1038/s41467-018-04398-z

[…] the sybr greener™ qpcr supermix system (invitrogen, carlsbad, ca). suitable amplification primers were designed using the primerselect tool of dnastar 14 software (madison, wi) or the ncbi online primer-blast program (supplementary table ). pcr reactions were performed in a volume of 10 μl containing 1 μl of diluted cdna, 5 μl of sybr greener™ qpcr supermix and 4 μl of primers mix (1 µm […]

PMCID: 5955947
PMID: 29769540
DOI: 10.1038/s41598-018-24974-z

[…] carried out using primer premier (version 6.0, premier biosoft international, usa). the mcra 997 f primer was newly designed in this study and the efficiency was confirmed in silico with the ncbi primer-blast tool.figure 4, about 0.5 ml liquid samples or 0.4 g sediment samples were used for dna extraction. the microbial dna was extracted using the fastdna spin kit for soil according […]

PMCID: 5948854
PMID: 29753320
DOI: 10.1186/s12933-018-0713-0

[…] relative expression of a target gene was calculated, based on qpcr efficiencies and the quantification cycle (cq) difference (δ) of an experimental sample versus control. primers were designed using primer blast tool (https://www.ncbi.nlm.nih.gov/tools/primer-blast/). primers were selected according to the following parameters: length between 18 and 24 bases, melting temperature (tm) between 58° […]

PMCID: 5944930
PMID: 29746477
DOI: 10.1371/journal.pone.0196438

[…] to the manufacturer’s instructions., qpcr was performed with a quantstudio 7 flex (applied biosystems, foster city, ca). primers were either adapted from existing literature or designed using primer-blast (http://www.ncbi.nlm.nih.gov/tools/primer-blast/) to include all splice variants, and were purchased from sigma-aldrich. detailed information and instructions for using primer-blast […]

PMCID: 5946446
PMID: 29747587
DOI: 10.1186/s12864-018-4738-2

[…] 3-phosphate dehydrogenase (gapdh) gene as the internal control to normalize the expression levels of target genes (primers: tggtgaaggtcggagtgaac, atggcgacgatgtccacttt). primers were designed using primer-blast [] and are described on additional file : table s7. the pcr efficiency was estimated for each primer set with linregpcr [], and relative expression values were calculated using […]


To access a full list of publications, you will need to upgrade to our premium service.

Primer-BLAST institution(s)
National Center for Biotechnology Information, National Library of Medicine, National Institutes of Health, Bethesda, MD, USA; Neuroscience and Behavioral Disorders Program, Duke-NUS Graduate Medical School, Singapore, Singapore
Primer-BLAST funding source(s)
Supported by the Intramural Research Program of the NIH, National Library of Medicine, the Singapore Ministry of Health and the Agency for Science, Technology, and Research.

Primer-BLAST reviews

star_border star_border star_border star_border star_border
star star star star star

Be the first to review Primer-BLAST