probeBase statistics

Tool stats & trends

Looking to identify usage trends or leading experts?

Protocols

probeBase specifications

Information


Unique identifier OMICS_10730
Name probeBase
Restrictions to use None
Maintained Yes

Maintainer


  • person_outline Alexander Loy

Publications for probeBase

probeBase citations

 (12)
call_split

Effect of maize root exudates on indole 3 acetic acid production by rice endophytic bacteria under influence of L tryptophan

2018
F1000Res
PMCID: 5829522
PMID: 29552336
DOI: 10.5256/f1000research.14823.r30252
call_split See protocol

[…] and RE17. Universal 16S rRNA primers (8F 5’ AGAGTTTGATCCTGGCTCAG 3’ and U1517R 5’ ACGG(A/C)TACCTTGTTACGACTT 3’) were used for 16S rRNA amplification of bacterial isolates under PCR reaction ( ). The ProbeBase online utility was used to check primers specificity and the BLAST search facility at the NCBI (Genbank database). Multiple sequence alignment was performed by using MUSCLE alignment algorit […]

library_books

Enhancing methane production from food waste fermentate using biochar: the added value of electrochemical testing in pre selecting the most effective type of biochar

2017
Biotechnol Biofuels
PMCID: 5729428
PMID: 29255486
DOI: 10.1186/s13068-017-0994-7

[…] 8I-III, labeled with fluorescein FLU) and Archaea (ARC915 probe, labeled with indocarbocyanine fluorescent dye, CY3) domains were used. Details of the employed oligonucleotide probes are available at probeBase [].To visualize specific cells within the 3D structure of the aggregates, FISH was combined with confocal laser scanning microscopy (CSLM; Olympus FV1000) [, ]. The hybridized bacterial cell […]

library_books

Deciphering functional diversification within the lichen microbiota by meta omics

2017
Microbiome
PMCID: 5518139
PMID: 28724401
DOI: 10.1186/s40168-017-0303-5

[…] EUB338III (42 °C, 15% formamide; [, ]). Additionally, NONEUB probes [] labeled with the respective fluorochromes were used as negative controls. Details about oligonucleotide probes are available on probeBase []. To suppress photobleaching of the fluorescently labeled probes, SlowFade Diamond antifade reagent (Molecular Probes, Eugene, USA) was used. Targeted Chthoniobacterales and all other euba […]

library_books

Culture Independent Analyses Reveal Novel Anaerolineaceae as Abundant Primary Fermenters in Anaerobic Digesters Treating Waste Activated Sludge

2017
Front Microbiol
PMCID: 5481317
PMID: 28690595
DOI: 10.3389/fmicb.2017.01134

[…] olinea submarina MO-CFX1T which has a single base mismatch. Pure cultures with a single base mismatch to the CFX-A6-450 probe were not available. Probes designed in this study were deposited into the probeBase database (). The ARCH915 and the MX825mix (MX825; MX825b; MX825c) (; ) probes were applied to target the domain Archaea and the genus Methanosaeta, respectively. Quantitative FISH (qFISH) va […]

library_books

‘Candidatus Cochliophilus cryoturris’ (Coxiellaceae), a symbiont of the testate amoeba Cochliopodium minus

2017
Sci Rep
PMCID: 5469826
PMID: 28611430
DOI: 10.1038/s41598-017-03642-8

[…] osymbiont-specific probe (PDD8-644, 5′-TCTTCGACTCCAGCCGCAC-3′) was designed using the ARB software package and validated with probeCheck and Silva testProbe 3.0, . The probe sequence was deposited at probeBase (http://probebase.net/pb_report/probe/4042). All probes were synthesized by Thermo Fisher Scientific (St. Leon-Rot, Germany). Hybridizations were performed by combining the specific probe PD […]

library_books

Single Cell Resolution of Uncultured Magnetotactic Bacteria via Fluorescence Coupled Electron Microscopy

2017
Appl Environ Microbiol
PMCID: 5452806
PMID: 28389550
DOI: 10.1128/AEM.00409-17

[…] GTCCAACGGCT-3′, positions 838 to 860) to specifically target 16S rRNA gene sequences of SHHR-1-like cells (). Probe specificity was evaluated by using the online probe evaluation tools probeCheck and probeBase (, ). Except for magnetotactic Gammaproteobacteria strain SS-5, no other sequence in the SILVA111 database has a matching complementary sequence (the minimum number of mismatches is 2). The […]

Citations

Looking to check out a full list of citations?

probeBase institution(s)
Division of Computational Systems Biology, Department of Microbiology and Ecosystem Science, Research Network Chemistry meets Microbiology, University of Vienna, Wien, Austria; Division of Microbial Ecology, Department of Microbiology and Ecosystem Science, Research Network Chemistry meets Microbiology, University of Vienna, Wien, Austria
probeBase funding source(s)
Austrian Science Fund [FWF, P25111-B22, I2320-B22, I1628-B22]; Vienna Science and Technology Fund [WWTF, LS12-001]; European Research Council ERC [StG EVOCHLAMY, 281633]

probeBase reviews

star_border star_border star_border star_border star_border
star star star star star

Be the first to review probeBase