ProtParam statistics

To access cutting-edge analytics on consensus tools, life science contexts and associated fields, you will need to subscribe to our premium service.

Subscribe
info

Citations per year

Citations chart
info

Popular tool citations

chevron_left Isoelectric point prediction chevron_right
Popular tools chart
info

Tool usage distribution map

Tool usage distribution map
info

Associated diseases

Associated diseases

ProtParam specifications

Information


Unique identifier OMICS_10652
Name ProtParam
Interface Web user interface
Restrictions to use None
Input data A protein sequence.
Computer skills Basic
Stability Stable
Maintained Yes

Maintainer


  • person_outline ProtParam Team <>

Publication for ProtParam

ProtParam in publications

 (1516)
PMCID: 5954444
PMID: 29780242
DOI: 10.1177/1177932218755337

[…] vaccines, including molecular weight (mw), isoelectric point (ip), stability index, half-life in vitro and in vivo, aliphatic index, and grand average of hydropathicity (gravy) were estimated by the protparam server (available at http://web.expasy.org/protparam)., to verify the peptide signal and consequently locate the c pseudotuberculosis, the signalp 4.1 software was used (available […]

PMCID: 5940787
PMID: 29739980
DOI: 10.1038/s41598-018-25315-w

[…] sequences of smdmls, atdmls and osdmls were analyzed for amino acid number, molecular weight (mw), theoretical isoelectric point (pi) using the expasy protoparam tool (http://www.expasy.org/tools/protparam.html). multiple sequence alignment was performed for smdml, atdml and osdml amino acid sequences using clustalw. conserved motifs in smdml, atdml and osdml proteins were detected using […]

PMCID: 5937781
PMID: 29734371
DOI: 10.1371/journal.pone.0196952

[…] the domain of the deduced zjomt protein was analyzed using conserved domain database (cdd) (https://www.ncbi.nlm.nih.gov/cdd). the theoretical pi and molecular weight were predicted by the protparam online software (http://web.expasy.org/protparam)., the cdna of leaves and roots of the al treated zoysiagrass was used as template, q-zjomt-f: tggtcgctgatagccaaatc and q-zjomt-r: […]

PMCID: 5940312
PMID: 29453311
DOI: 10.1083/jcb.201711047

[…] glycerol for overnight incubation with human rhinovirus 3c protease and protein elution., ir concentration was estimated using a molar extinction coefficient of 377,585 m−1 cm−1 as calculated by protparam (expasy), assuming 42 of the total 94 cysteines are forming disulfide bonds in the dimeric receptor (). the typical yield of purified ir was ∼0.5 mg from 1 liter of cell culture., […]

PMCID: 5945869
PMID: 29780329
DOI: 10.3389/fphys.2018.00482

[…] in clustalx 2 software () and jalview 2.9. a phylogenetic tree of these sequences was constructed by neighbor joining in 5.0 () with 1,000 bootstrap replicates. in addition, the online software tool protparam was used to predict the molecular mass and isoelectric point of bdmet and bdkr-h1. finally, the signalp server was used to predict signal peptides., following first-strand cdna synthesis […]


To access a full list of publications, you will need to upgrade to our premium service.

ProtParam funding source(s)
Supported by the National Institutes of Health (NIH) grant 1 U01 HG02712-01 and by the Swiss Federal Government through the Federal Office of Education and Science.

ProtParam reviews

star_border star_border star_border star_border star_border
star star star star star

Be the first to review ProtParam