Pseudomonas Genome Database statistics

Tool stats & trends

Looking to identify usage trends or leading experts?

Protocols

Pseudomonas Genome Database specifications

Information


Unique identifier OMICS_03209
Name Pseudomonas Genome Database
Restrictions to use None
Data access File download, Browse
User data submission Allowed
Maintained Yes
Wikipedia https://en.wikipedia.org/wiki/Pseudomonas_genome_database

Maintainer


  • person_outline Fio S.L. Brinkman

Publications for Pseudomonas Genome Database

Pseudomonas Genome Database citations

 (59)
library_books

Community led comparative genomic and phenotypic analysis of the aquaculture pathogen Pseudomonas baetica a390T sequenced by Ion semiconductor and Nanopore technologies

2018
FEMS Microbiol Lett
PMCID: 5909648
PMID: 29579234
DOI: 10.1093/femsle/fny069

[…] y over that using Ion PGM reads only giving 16 contigs over 1000 bp (Table ). Quast analysis of the combined assembly gives an N50 value of 973739 which is higher than 96% of all draft genomes in The Pseudomonas Genome database.The Ion PGM-only and the hybrid assembly graphs were also inspected visually using Bandage (Wick et al.) in order to assess the fragmentation of the genome assemblies and t […]

library_books

Genomic insights into the broad antifungal activity, plant probiotic properties, and their regulation, in Pseudomonas donghuensis strain SVBP6

2018
PLoS One
PMCID: 5851621
PMID: 29538430
DOI: 10.1371/journal.pone.0194088

[…] GP-related traits in the draft genome of SVBP6 strain were performed with the Rapid Annotation with Subsystems Technology (RAST) server database .0 [], Basic Local Alignment Search Tool (BLAST®, []), Pseudomonas genome database (www.pseudomonas.com, []), Antibiotics & Secondary Metabolite Analysis Shell (antiSMASH) v. 3.0.5 [] and the IslandViewer 3 software []. Synteny analyses were performed wit […]

library_books

Genome editing and transcriptional repression in Pseudomonas putida KT2440 via the type II CRISPR system

2018
Microb Cell Fact
PMCID: 5851096
PMID: 29534717
DOI: 10.1186/s12934-018-0887-x

[…] pSEVA-gRicF was derived from pSEVA-gRNAT by replacing the original N20 sequence with ‘AAAATCGCAATCGTCGGTGC’ via inverse PCR using primers NC-F/NC-R. The homologous arms of nicC were acquired from the Pseudomonas Genome Database []. Next, 500 bp length upstream and downstream of the target gene were amplified using primers NT-1F/NT-2R, NT-ZF/NT-ZR, and connected via overlap-extension (SOE) PCR. The […]

call_split

Transcriptome Analysis of Pseudomonas aeruginosa Cultured in Human Burn Wound Exudates

2018
PMCID: 5835353
PMID: 29535973
DOI: 10.3389/fcimb.2018.00039
call_split See protocol

[…] h HTseq v0.6.1 and the differential expression analysis was performed with the R/Bioconductor EdgeR v3.4.2 package with a GLM (generalized linear model) test. Gene identity numbers were obtained from Pseudomonas Genome Database (www.pseudomonas.com). […]

call_split

An upstream sequence modulates phenazine production at the level of transcription and translation in the biological control strain Pseudomonas chlororaphis 30 84

2018
PLoS One
PMCID: 5815613
PMID: 29451920
DOI: 10.1371/journal.pone.0193063
call_split See protocol

[…] To obtain the nucleotide sequence upstream of phenazine biosynthetic operon, the 250 bp nucleotide sequence upstream of the translation start site of phzX were blasted against the Pseudomonas Genome Database (www.pseudomonas.com) and National Center for Biotechnology Information (NCBI, https://www.ncbi.nlm.nih.gov/). A total of 27 phenazine producing strains were retrieved and […]

library_books

Conserved, unstructured regions in Pseudomonas aeruginosa PilO are important for type IVa pilus function

2018
Sci Rep
PMCID: 5805733
PMID: 29422606
DOI: 10.1038/s41598-018-20925-w

[…] The P. aeruginosa PAK PilO sequence was retrieved from the Pseudomonas Genome Database and was aligned using Jalview 2.8.2, with a subset of Pseudomonads (P. fluorescens, P. syringae pv. phaseolicola 1448 A, P. savastanoi, P. syringae, P. protegens CHA0, P. a […]

Citations

Looking to check out a full list of citations?

Pseudomonas Genome Database institution(s)
Department of Molecular Biology and Biochemistry, Simon Fraser University, Greater Vancouver, Canada
Pseudomonas Genome Database funding source(s)
Cystic Fibrosis Foundation Therapeutics; Cystic Fibrosis Canada; Natural Sciences and Engineering Research Council of Canada; Genome Canada; Cystic Fibrosis Canada Scholarship; Canadian Institutes for Health Research Bioinformatics Training Program scholarship

Pseudomonas Genome Database reviews

star_border star_border star_border star_border star_border
star star star star star

Be the first to review Pseudomonas Genome Database