pyQPCR statistics

Tool stats & trends

Looking to identify usage trends or leading experts?

Protocols

pyQPCR specifications

Information


Unique identifier OMICS_02326
Name pyQPCR
Software type Package/Module
Interface Command line interface
Restrictions to use None
Operating system Unix/Linux
Programming languages Python
License GNU General Public License version 2.0
Computer skills Advanced
Stability Stable
Maintained Yes

Versioning


No version available

pyQPCR citations

 (6)
library_books

Diverse feather shape evolution enabled by coupling anisotropic signalling modules with self organizing branching programme

2017
Nat Commun
PMCID: 5263876
PMID: 28106042
DOI: 10.1038/ncomms14139

[…] gagcttgattctgg and ttgcaaggtcattggcataa; Maxima SYBR Green/ROX qPCR Mix was from Thermo Scientific. The Ct values were measured by Agilent Mx3000P qPCR system. The relative quantification was done by pyQPCR v0.9 software. Each condition has at least two biological replicates and three technical replicates. […]

library_books

Genome wide chromatin and gene expression profiling during memory formation and maintenance in adult mice

2016
Sci Data
PMCID: 5058335
PMID: 27727234
DOI: 10.1038/sdata.2016.90

[…] aster mix (Roche) with custom primers (Sigma Aldrich). For the validation of DMRs, 2 nM MeDIP libraries were diluted 1:50 and 5 μl of DNA was used into 15 μl PCR reaction. The data was analysed using pyQPCR (v0.10dev, pyqpcr.sourceforge.net) with absolute quantification using dilution of inputs as standard samples, error type Gaussian, confidence interval of 90%, maximum E(Ct) of 0.3 and minimum C […]

library_books

Copper as a target for prostate cancer therapeutics: copper ionophore pharmacology and altering systemic copper distribution

2016
Oncotarget
PMCID: 5095059
PMID: 27175597
DOI: 10.18632/oncotarget.9245

[…] esby, Australia; Cat#4367659) using the AB 7500 Real Time PCR System (Applied Biosystems). Primer efficiencies were taken into consideration when comparing relative amounts of mRNA to the liver using pyQPCR Software v0.9. […]

library_books

The hematopoietic regulator, ELF 1, enhances the transcriptional response to Interferon β of the OAS1 anti viral gene

2015
Sci Rep
PMCID: 4672336
PMID: 26643049
DOI: 10.1038/srep17497

[…] ctions was checked against a standard curve using serially diluted pooled cDNA. All reactions were performed in triplicate and normalized to GAPDH expression levels, calculations were performed using pyQPCR analysis suite (http://pyqpcr.sourceforge.net/) by the ΔΔCt method. […]

call_split

Loss of function of 1 FEH IIb has more impact on post harvest inulin degradation in Cichorium intybus than copy number variation of its close paralog 1 FEH IIa

2015
Front Plant Sci
PMCID: 4477480
PMID: 26157446
DOI: 10.3389/fpls.2015.00455
call_split See protocol

[…] qPCR were performed on ABi StepOnePlusTM Real-Time PCR Systems with standard 2 h runs, comparative Ct quantification (ΔΔCt) and SYBR® green detection parameters. PCR efficiencies were calculated with pyQPCR (available for download at http://pyqpcr.sourceforge.net/?static2/download), an interface for the qBase algorithm (). PCR efficiency was calculated with the formula E = [10(–1/slope)–1]∗100. Th […]

library_books

A survey of tools for the analysis of quantitative PCR (qPCR) data

2014
PMCID: 5129434
PMID: 27920994
DOI: 10.1016/j.bdq.2014.08.002

[…] ith a specific format. Currently, it supports one ABI system and performs data processing in a semi-automated way. Quantification results are exported in a new Excel file containing calculated values.pyQPCR is a Python based application that provides a modern graphical user interface. It takes Cq values as input and supports data import from a few Eppendorf and ABI systems file formats. The method […]

Citations

Looking to check out a full list of citations?

pyQPCR reviews

star_border star_border star_border star_border star_border
star star star star star

Be the first to review pyQPCR