QuantPrime protocols

View QuantPrime computational protocol

QuantPrime statistics

To access cutting-edge analytics on consensus tools, life science contexts and associated fields, you will need to subscribe to our premium service.

Subscribe
info

Citations per year

Citations chart
info

Popular tool citations

chevron_left Conventional primer design chevron_right
Popular tools chart
info

Tool usage distribution map

Tool usage distribution map
info

Associated diseases

Associated diseases

QuantPrime specifications

Information


Unique identifier OMICS_02368
Name QuantPrime
Software type Package/Module
Interface Command line interface
Restrictions to use None
Operating system Unix/Linux
Computer skills Advanced
Stability Stable
Maintained Yes

Versioning


Add your version

Documentation


Maintainers


  • person_outline Bernd Mueller-Roeber <>
  • person_outline Samuel Arvidsson <>

Additional information


A registration is needed to access to tools.

Information


Unique identifier OMICS_02368
Name QuantPrime
Interface Web user interface
Restrictions to use Academic or non-commercial use
Programming languages PHP, Python
Computer skills Basic
Stability Stable

Documentation


Maintainers


This tool is not maintained anymore.

Additional information


A registration is needed to access to tools.

Publication for QuantPrime

QuantPrime in pipelines

 (2)
2015
PMCID: 4682430
PMID: 26463996
DOI: 10.1093/jxb/erv449

[…] )., approximately 500ng of total rna were reverse transcribed using superscript™ iii first-strand synthesis supermix for qrt-pcr kit (invitrogen). primers were designed with quantprime software (http://www.quantprime.de/) and are listed in supplementary table s1 at jxb online. constitutively expressed genes encoding, respectively, a ubiquitin and an atp synthase beta […]


To access a full list of citations, you will need to upgrade to our premium service.

QuantPrime in publications

 (95)
PMCID: 5826256
PMID: 29515599
DOI: 10.3389/fpls.2018.00157

[…] step was included for all samples. cdna was synthesized from 750 ng of total rna using superscript iv vilo (life technologies, carlsbad, ca, united states). for real-time pcr (rt-pcr) analysis, quantprime primer design webtool () was used to design zmtom1 primers. the primer efficiency of each set of primers (supplementary table ) was evaluated empirically by serial dilution curve of cdna. […]

PMCID: 5799827
PMID: 29449851
DOI: 10.3389/fpls.2018.00048

[…] autophagy-related genes from the autophagy database (rrid:scr_002671; ), and peptidases from the merops database(rrid:scr_002671; )., primers for quantitative real-time pcr (qpcr) were calculated by quantprime () after importing the b. napus unigene assemblies (supplementary table ). one μg dnase i-digested total rna was used for cdna synthesis using superscript iii reverse transcriptase […]

PMCID: 5792024
PMID: 29351292
DOI: 10.1371/journal.pgen.1007185

[…] discs., the following primers were used to detect toy, ey, tsh, tio and so transcripts using rt-qpcr: toy f: 5’-cca gag gca cgt att cag gtt tgg-3’; toy r: 5’-tta ttt gcc gtg ctg gtt cga c-3’ (quantprime) []; ey f: 5’-tgg tag gtc aat cac cca acc-3’; ey r: 5’-gct gct gta gtg cct gat gg-3’; tsh f: 5’-tcg cac caa tct tta tgg aag g; tsh r: gta cct aca gag aga tcg agt gg-3’; tio f: 5’-gag gcc […]

PMCID: 5773127
PMID: 29346382
DOI: 10.1371/journal.pgen.1007125

[…] instructions. the cdna was analysed by qrt-pcr using the steponeplus real-time pcr system (applied biosystems) applying melting temperature of 62°c. the following primers were designed using quantprime []: ttr-33/c37c3.13.2_f: acccaatcagctggagttaaggg and ttr-33/c37c3.13.2_r: atccggtccggtatcatcatcg, gst-4/k08f4.7_f: atggtcaaagctgaagccaacg and gst-4/k08f4.7_r: actgaccgaattgttctccatcg, […]

PMCID: 5773152
PMID: 29346364
DOI: 10.1371/journal.pgen.1007106

[…] instructions. the cdna was analysed by qrt-pcr using the steponeplus real-time pcr system (applied biosystems) applying melting temperature of 62°c. the following primers were designed using quantprime []: k08f4.7_f: atggtcaaagctgaagccaacg and k08f4.7_r: actgaccgaattgttctccatcg, f37b12.2.1_f: gttgatgtggatactcggtgtacg and f37b12.2.1_r: atctctccagttgctcgtttcg, r107.7.1_f: […]


To access a full list of publications, you will need to upgrade to our premium service.

QuantPrime institution(s)
Max-Planck Institute of Molecular Plant Physiology, Potsdam-Golm, Germany; Institute of Biochemistry and Biology, University of Potsdam, Potsdam-Golm, Germany; Department of Genetics, University of Silesia, Katowice, Poland
QuantPrime funding source(s)
Supported through the EU Marie Curie Research Training Network 'VaTEP – Vacuolar Transport Equipment for Growth Regulation of Plants' (MRTN-CT-2006-035833), the DAAD for a fellowship provided through the program 'Modern Applications of Biotechnology' (A/06/04209), the Polish Ministry of Science and Higher Education (research grant 2 P04C 056 30), the Interdisciplinary Research Center 'Advanced Protein Technologies' of the University of Potsdam, the Fonds der Chemischen Industrie (0164389), the Bundesministerium fuer Bildung und Forschung (BMBF) (GABI-FUTURE grant 0315046) and the BMBF for funding of the systems biology research unit 'GoFORSYS – Potsdam-Golm BMBF Forschungseinrichtung zur Systembiologie. Photosynthesis and Growth; a Systems Biology Based Approach' (FKZ 0313924).

QuantPrime reviews

star_border star_border star_border star_border star_border
star star star star star

Be the first to review QuantPrime