QuantPrime statistics

info info

Citations per year

info

Tool usage distribution map

info info

Associated diseases

info

Popular tool citations

chevron_left Conventional primer design chevron_right
Want to access the full stats & trends on this tool?

Protocols

QuantPrime specifications

Information


Unique identifier OMICS_02368
Name QuantPrime
Software type Package/Module
Interface Command line interface
Restrictions to use None
Operating system Unix/Linux
Computer skills Advanced
Stability Stable
Maintained Yes

Versioning


No version available

Documentation


Maintainers


  • person_outline Bernd Mueller-Roeber
  • person_outline Samuel Arvidsson

Additional information


A registration is needed to access to tools.

Information


Unique identifier OMICS_02368
Name QuantPrime
Interface Web user interface
Restrictions to use Academic or non-commercial use
Programming languages PHP, Python
Computer skills Basic
Stability Stable

Documentation


Maintainers


This tool is not maintained anymore.

Additional information


A registration is needed to access to tools.

Publication for QuantPrime

QuantPrime citations

 (105)
library_books

Analysis of Yellow Striped Mutants of Zea mays Reveals Novel Loci Contributing to Iron Deficiency Chlorosis

2018
Front Plant Sci
PMCID: 5826256
PMID: 29515599
DOI: 10.3389/fpls.2018.00157

[…] tment step was included for all samples. cDNA was synthesized from 750 ng of total RNA using SuperScript IV VILO (Life Technologies, Carlsbad, CA, United States). For real-time PCR (RT-PCR) analysis, Quantprime primer design webtool () was used to design ZmTOM1 primers. The primer efficiency of each set of primers (Supplementary Table ) was evaluated empirically by serial dilution curve of cDNA. P […]

library_books

Divergent N Deficiency Dependent Senescence and Transcriptome Response in Developmentally Old and Young Brassica napus Leaves

2018
Front Plant Sci
PMCID: 5799827
PMID: 29449851
DOI: 10.3389/fpls.2018.00048

[…] Primers for quantitative real-time PCR (qPCR) were calculated by QuantPrime () after importing the B. napus unigene assemblies (Supplementary Table ). One μg DNase I-digested total RNA was used for cDNA synthesis using SuperScript III Reverse Transcriptase (ThermoF […]

library_books

Allocation of distinct organ fates from a precursor field requires a shift in expression and function of gene regulatory networks

2018
PLoS Genet
PMCID: 5792024
PMID: 29351292
DOI: 10.1371/journal.pgen.1007185

[…] imaginal discs.The following primers were used to detect toy, ey, tsh, tio and so transcripts using RT-qPCR: toy F: 5’-CCA GAG GCA CGT ATT CAG GTT TGG-3’; toy R: 5’-TTA TTT GCC GTG CTG GTT CGA C-3’ (QuantPrime) []; ey F: 5’-TGG TAG GTC AAT CAC CCA ACC-3’; ey R: 5’-GCT GCT GTA GTG CCT GAT GG-3’; tsh F: 5’-TCG CAC CAA TCT TTA TGG AAG G; tsh R: GTA CCT ACA GAG AGA TCG AGT GG-3’; tio F: 5’-GAG GCC GT […]

library_books

6 OHDA induced dopaminergic neurodegeneration in Caenorhabditis elegans is promoted by the engulfment pathway and inhibited by the transthyretin related protein TTR 33

2018
PLoS Genet
PMCID: 5773127
PMID: 29346382
DOI: 10.1371/journal.pgen.1007125

[…] cturers’ instructions. The cDNA was analysed by qRT-PCR using the StepOnePlus Real-Time PCR System (Applied Biosystems) applying melting temperature of 62°C. The following primers were designed using QuantPrime []: ttr-33/C37C3.13.2_F: ACCCAATCAGCTGGAGTTAAGGG and ttr-33/C37C3.13.2_R: ATCCGGTCCGGTATCATCATCG, gst-4/K08F4.7_F: ATGGTCAAAGCTGAAGCCAACG and gst-4/K08F4.7_R: ACTGACCGAATTGTTCTCCATCG, gcs-1 […]

library_books

Mutations in Caenorhabditis elegans neuroligin like glit 1, the apoptosis pathway and the calcium chaperone crt 1 increase dopaminergic neurodegeneration after 6 OHDA treatment

2018
PLoS Genet
PMCID: 5773152
PMID: 29346364
DOI: 10.1371/journal.pgen.1007106

[…] cturers’ instructions. The cDNA was analysed by qRT-PCR using the StepOnePlus Real-Time PCR System (Applied Biosystems) applying melting temperature of 62°C. The following primers were designed using QuantPrime []: K08F4.7_F: ATGGTCAAAGCTGAAGCCAACG and K08F4.7_R: ACTGACCGAATTGTTCTCCATCG, F37B12.2.1_F: GTTGATGTGGATACTCGGTGTACG and F37B12.2.1_R: ATCTCTCCAGTTGCTCGTTTCG, R107.7.1_F: CGTCATCTCGCTCGTCTT […]

call_split

No Time to Waste: Transcriptome Study Reveals that Drought Tolerance in Barley May Be Attributed to Stressed Like Expression Patterns that Exist before the Occurrence of Stress

2018
Front Plant Sci
PMCID: 5767312
PMID: 29375595
DOI: 10.3389/fpls.2017.02212
call_split See protocol

[…] o the manufacturer's instructions. The cDNA was diluted 1:5 with ddH2O and used as a template for the qPCR. The primers that were used in the qPCR were designed using Quant-Prime software (http://www.quantprime.de). The 10 μl qPCR reaction contained 2 μl of cDNA, 1 μl of the primer pair mixture (5 μM), and 5 μl of 2 × Master Mix (LightCycler 480 SYBR Green I Master; Roche). The qPCR protocol for t […]


Want to access the full list of citations?
QuantPrime institution(s)
Max-Planck Institute of Molecular Plant Physiology, Potsdam-Golm, Germany; Institute of Biochemistry and Biology, University of Potsdam, Potsdam-Golm, Germany; Department of Genetics, University of Silesia, Katowice, Poland
QuantPrime funding source(s)
Supported through the EU Marie Curie Research Training Network 'VaTEP – Vacuolar Transport Equipment for Growth Regulation of Plants' (MRTN-CT-2006-035833), the DAAD for a fellowship provided through the program 'Modern Applications of Biotechnology' (A/06/04209), the Polish Ministry of Science and Higher Education (research grant 2 P04C 056 30), the Interdisciplinary Research Center 'Advanced Protein Technologies' of the University of Potsdam, the Fonds der Chemischen Industrie (0164389), the Bundesministerium fuer Bildung und Forschung (BMBF) (GABI-FUTURE grant 0315046) and the BMBF for funding of the systems biology research unit 'GoFORSYS – Potsdam-Golm BMBF Forschungseinrichtung zur Systembiologie. Photosynthesis and Growth; a Systems Biology Based Approach' (FKZ 0313924).

QuantPrime reviews

star_border star_border star_border star_border star_border
star star star star star

Be the first to review QuantPrime