QuasiMotiFinder specifications

Information


Unique identifier OMICS_07745
Name QuasiMotiFinder
Interface Web user interface
Restrictions to use None
Computer skills Basic
Version 4.0
Stability Stable
Maintained Yes

Maintainer


  • person_outline QuasiMotiFinder <>

Publication for QuasiMotiFinder

QuasiMotiFinder in publications

 (3)
PMCID: 3326958
PMID: 22529627
DOI: 10.4103/0974-777X.93761

[…] and myristoyl-coa: protein n-myristoyltransferase signature 2(kfgegdg) were found. pattern, probability and description of the motifs are presented []. 3 pseudomotifs were also predicted using quasimotifinder apart from those predicted using proscan []., disuphide bridges known as “switches for protein function”,[] result from covalent bonding of suphur from cysteine residues. disulphide […]

PMCID: 2944959
PMID: 20390432
DOI: 10.1007/s10048-010-0243-8

[…] cgaacaatcccttccagatt 3′). all clones were verified using internal sequencing primers. multiple sequence alignments were generated using multalin software [], and motif analysis was performed with quasimotifinder []., to determine exon 1 of the zebrafish spg11 gene, 5′ ready amplification of cdna ends (5′ race) was performed using the generacer race ready cdna kit (invitrogen) according […]

PMCID: 2396637
PMID: 18460207
DOI: 10.1186/1471-2105-9-229

[…] predict the particular evolutionary history of each instance, which is a different and non-trivial task., conservation scores have been repeatedly implemented in order to improve lm prediction. the quasimotifinder [] algorithm uses a maximum likelihood-based model [] to estimate the conservation of instances that resemble prosite signatures. while being a very robust statistical approach, […]


To access a full list of publications, you will need to upgrade to our premium service.

QuasiMotiFinder institution(s)
Department of Biochemistry, The George S Wise Faculty of Life Sciences, Tel Aviv University Ramat Aviv, Israel

QuasiMotiFinder reviews

star_border star_border star_border star_border star_border
star star star star star

Be the first to review QuasiMotiFinder