QuasiMotiFinder statistics

Tool stats & trends

Looking to identify usage trends or leading experts?

Protocols

QuasiMotiFinder specifications

Information


Unique identifier OMICS_07745
Name QuasiMotiFinder
Interface Web user interface
Restrictions to use None
Computer skills Basic
Version 4.0
Stability Stable
Maintained Yes

Maintainer


  • person_outline QuasiMotiFinder

Publication for QuasiMotiFinder

QuasiMotiFinder citations

 (5)
library_books

Analyzing a Potential Drug Target N Myristoyltransferase of Plasmodium falciparum Through In Silico Approaches

2012
PMCID: 3326958
PMID: 22529627
DOI: 10.4103/0974-777X.93761

[…] LCVHK) and Myristoyl-CoA: Protein N-myristoyltransferase signature 2(KFGEGDG) were found. Pattern, probability and description of the motifs are presented []. 3 pseudomotifs were also predicted using Quasimotifinder apart from those predicted using PROSCAN [].Disuphide bridges known as “switches for protein function”,[] result from covalent bonding of suphur from cysteine residues. Disulphide brid […]

call_split

Novel SPG11 mutations in Asian kindreds and disruption of spatacsin function in the zebrafish

2010
PMCID: 2944959
PMID: 20390432
DOI: 10.1007/s10048-010-0243-8
call_split See protocol

[…] (5′ CGAACAATCCCTTCCAGATT 3′). All clones were verified using internal sequencing primers. Multiple sequence alignments were generated using MultAlin software [], and motif analysis was performed with QuasiMotiFinder []. […]

library_books

A tree based conservation scoring method for short linear motifs in multiple alignments of protein sequences

2008
BMC Bioinformatics
PMCID: 2396637
PMID: 18460207
DOI: 10.1186/1471-2105-9-229

[…] to predict the particular evolutionary history of each instance, which is a different and non-trivial task.Conservation scores have been repeatedly implemented in order to improve LM prediction. The QuasiMotiFinder [] algorithm uses a maximum likelihood-based model [] to estimate the conservation of instances that resemble Prosite signatures. While being a very robust statistical approach, it is […]

library_books

A new protein linear motif benchmark for multiple sequence alignment software

2008
BMC Bioinformatics
PMCID: 2374782
PMID: 18439277
DOI: 10.1186/1471-2105-9-213

[…] particular instances that are known to be functional. Such data collections include the eukaryotic linear motif (ELM) resource [] and ScanSite []. A number of tools have been developed, e.g. ELM [], QuasiMotiFinder [], MiniMotif [] and the ACS method [], that employ various methods, such as domain masking and evolutionary filtering respectively, to discover new occurrences of previously known mot […]

library_books

SLiMDisc: short, linear motif discovery, correcting for common evolutionary descent

2006
Nucleic Acids Res
PMCID: 1524906
PMID: 16855291
DOI: 10.1093/nar/gkl486

[…] () efficiently discovering protein family signatures and other conserved regions, identifying SLiMs presents an inherently greater challenge. Web servers, such as eukaryotic linear motif (ELM) () and QuasiMotiFinder () employ various methods, such as domain masking and evolutionary filtering respectively, to discover new occurrences of previously known motifs. However, the web-based LMD method () […]

Citations

Looking to check out a full list of citations?

QuasiMotiFinder institution(s)
Department of Biochemistry, The George S Wise Faculty of Life Sciences, Tel Aviv University Ramat Aviv, Israel

QuasiMotiFinder reviews

star_border star_border star_border star_border star_border
star star star star star

Be the first to review QuasiMotiFinder