Ribomap statistics

info info

Citations per year

info

Tool usage distribution map

info info

Associated diseases

info

Popular tool citations

chevron_left Isoform-level footprint estimation chevron_right
Want to access the full stats & trends on this tool?

Ribomap specifications

Information


Unique identifier OMICS_20338
Name Ribomap
Software type Package/Module
Interface Command line interface
Restrictions to use None
Operating system Unix/Linux, Mac OS
Programming languages C++
Computer skills Advanced
Stability Stable
Requirements
Sailfish/Salmon, STAR, boost, seqan, a C++ compiler
Maintained Yes

Download


download.png

Versioning


No version available

Documentation


Maintainer


  • person_outline Carl Kingsford

Publication for Ribomap

Ribomap citations

 (15)
library_books

miR‐125b‐1 and miR‐378a are predictive biomarkers for the efficacy of vaccine treatment against colorectal cancer

2017
Cancer Sci
PMCID: 5666028
PMID: 28859241
DOI: 10.1111/cas.13390

[…] ISH was carried out on 5‐μm‐thick sections of FFPE samples using the RiboMap Kit (Ventana Medical Systems, Tucson, AZ, USA) on the Discovery ULTRA automated ISH instrument (Ventana Medical Systems). Probes were 5′ DIG‐labelled ISH LNAs (miRCURY‐LNA detection probes; Ex […]

library_books

Large scale genomic reorganization of topological domains at the HoxD locus

2017
Genome Biol
PMCID: 5547506
PMID: 28784160
DOI: 10.1186/s13059-017-1278-z

[…] were dried for 30 minutes, post-fixed in 4% paraformaldehyde for 10 minutes, and quenched with 0.6% H2O2 in methanol for 20 minutes. Slides were then processed using the Ventana Discovery xT with the RiboMap kit. The pretreatment was performed with mild heating in CC2 for 12 minutes, followed by protease3 (Ventana, Roche) for 20 minutes at room temperature. Finally, the sections were hybridized us […]

library_books

The long non coding RNA GAS5 differentially regulates cell cycle arrest and apoptosis through activation of BRCA1 and p53 in human neuroblastoma

2016
Oncotarget
PMCID: 5351655
PMID: 28035057
DOI: 10.18632/oncotarget.14244

[…] eled probes for human lncRNA GAS5 FL (ggtatgacaggaactgtcttcatgtcc) and lncRNA GAS5 C2 (cgactctccatacccaagcaagtc) were used for RNA–FISH. In situ hybridization was performed on a Ventana machine using RiboMap in situ hybridization kit (Ventana Medical Systems, Inc.). The cell suspension was diluted to 10,000 cells/100 μL and plated on autoclaved glass slides. The next day, slides were washed in PBS […]

library_books

Insights into the mechanisms of eukaryotic translation gained with ribosome profiling

2016
Nucleic Acids Res
PMCID: 5314775
PMID: 27923997
DOI: 10.1093/nar/gkw1190

[…] lone tools were developed for differential gene expression analysis (anota (), Babel (), RiboDiff (), Xtail ()), and for the prediction of translated ORFs (RiboTaper (), ORF-Rator () and riboHMM ()). Ribomap () estimates footprint origins in the presence of multiple splice isoforms and repetitive regions and Rfoot () uses RiboSeq data to predict non-ribosome protected RNA sites. Additional RiboSeq […]

library_books

Limited Contribution of IL 36 versus IL 1 and TNF Pathways in Host Response to Mycobacterial Infection

2015
PLoS One
PMCID: 4423901
PMID: 25950182
DOI: 10.1371/journal.pone.0126058

[…] perfrost slides and loaded onto the Discovery automated slide-processing system (Ventana Medical Systems, Inc). Baking and deparaffinization steps were performed as programmed in the protocol for the RiboMap in situ hybridization reagent system (Ventana Medical Systems, Inc) on the instrument. In situ hybridization protocol was designed based on the standard protocol described in the manufacture's […]

library_books

Prevalence of canid herpesvirus 1 infection in stillborn and dead neonatal puppies in Denmark

2015
PMCID: 4296690
PMID: 25567292
DOI: 10.1186/s13028-014-0092-9

[…] ese slides were then submitted to deparaffinization and fixation using the Discovery XT automated slide processing system (Ventana Medical Systems, Inc., Tucson, AZ), as programed in the protocol for RiboMap ISH reagent system (Ventana Medical Systems). Proteolytic treatment was performed using Protease 3 (0.02 units/ml alkaline protease, Ventana Medical Systems) for 12 min at 37°C. Thereafter, th […]


Want to access the full list of citations?
Ribomap institution(s)
Computational Biology Department, School of Computer Science, Carnegie Mellon University, Pittsburgh, PA, USA; Department of Biological Sciences, Carnegie Mellon University, Pittsburgh, PA, USA
Ribomap funding source(s)
Supported in part by the Gordon and Betty Moore Foundation’s DataDriven Discovery Initiative through Grant GBMF4554 to Carl Kingsford, the US National Science Foundation [CCF-1256087, CCF-1319998], US National Institutes of Health [R21HG006913, R01HG007104] and an Alfred P. Sloan Research Fellow.

Ribomap reviews

star_border star_border star_border star_border star_border
star star star star star

Be the first to review Ribomap