Ribomap statistics

To access cutting-edge analytics on consensus tools, life science contexts and associated fields, you will need to subscribe to our premium service.

Subscribe
info

Citations per year

Citations chart
info

Popular tool citations

chevron_left Isoform-level footprint estimation chevron_right
Popular tools chart
info

Tool usage distribution map

Tool usage distribution map
info

Associated diseases

Associated diseases

Ribomap specifications

Information


Unique identifier OMICS_20338
Name Ribomap
Software type Package/Module
Interface Command line interface
Restrictions to use None
Operating system Unix/Linux, Mac OS
Programming languages C++
Computer skills Advanced
Stability Stable
Requirements
Sailfish/Salmon, STAR, boost, seqan, a C++ compiler
Maintained Yes

Download


Versioning


Add your version

Documentation


Maintainer


  • person_outline Carl Kingsford <>

Publication for Ribomap

Ribomap in publications

 (15)
PMCID: 5666028
PMID: 28859241
DOI: 10.1111/cas.13390

[…] using sds software v1.3.1 (life technologies). threshold and baseline settings were set according to protocol recommendations., ish was carried out on 5‐μm‐thick sections of ffpe samples using the ribomap kit (ventana medical systems, tucson, az, usa) on the discovery ultra automated ish instrument (ventana medical systems). probes were 5′ dig‐labelled ish lnas (mircury‐lna detection probes; […]

PMCID: 5547506
PMID: 28784160
DOI: 10.1186/s13059-017-1278-z

[…] dried for 30 minutes, post-fixed in 4% paraformaldehyde for 10 minutes, and quenched with 0.6% h2o2 in methanol for 20 minutes. slides were then processed using the ventana discovery xt with the ribomap kit. the pretreatment was performed with mild heating in cc2 for 12 minutes, followed by protease3 (ventana, roche) for 20 minutes at room temperature. finally, the sections were hybridized […]

PMCID: 5351655
PMID: 28035057
DOI: 10.18632/oncotarget.14244

[…] probes for human lncrna gas5 fl (ggtatgacaggaactgtcttcatgtcc) and lncrna gas5 c2 (cgactctccatacccaagcaagtc) were used for rna–fish. in situ hybridization was performed on a ventana machine using ribomap in situ hybridization kit (ventana medical systems, inc.). the cell suspension was diluted to 10,000 cells/100 μl and plated on autoclaved glass slides. the next day, slides were washed […]

PMCID: 5314775
PMID: 27923997
DOI: 10.1093/nar/gkw1190

[…] tools were developed for differential gene expression analysis (anota (), babel (), ribodiff (), xtail ()), and for the prediction of translated orfs (ribotaper (), orf-rator () and ribohmm ()). ribomap () estimates footprint origins in the presence of multiple splice isoforms and repetitive regions and rfoot () uses riboseq data to predict non-ribosome protected rna sites. additional […]

PMCID: 4423901
PMID: 25950182
DOI: 10.1371/journal.pone.0126058

[…] slides and loaded onto the discovery automated slide-processing system (ventana medical systems, inc). baking and deparaffinization steps were performed as programmed in the protocol for the ribomap in situ hybridization reagent system (ventana medical systems, inc) on the instrument. in situ hybridization protocol was designed based on the standard protocol described […]


To access a full list of publications, you will need to upgrade to our premium service.

Ribomap institution(s)
Computational Biology Department, School of Computer Science, Carnegie Mellon University, Pittsburgh, PA, USA; Department of Biological Sciences, Carnegie Mellon University, Pittsburgh, PA, USA
Ribomap funding source(s)
Supported in part by the Gordon and Betty Moore Foundation’s DataDriven Discovery Initiative through Grant GBMF4554 to Carl Kingsford, the US National Science Foundation [CCF-1256087, CCF-1319998], US National Institutes of Health [R21HG006913, R01HG007104] and an Alfred P. Sloan Research Fellow.

Ribomap reviews

star_border star_border star_border star_border star_border
star star star star star

Be the first to review Ribomap