RNA Designer statistics

To access cutting-edge analytics on consensus tools, life science contexts and associated fields, you will need to subscribe to our premium service.

Subscribe
info

Citations per year

Citations chart
info

Popular tool citations

chevron_left RNA design chevron_right
Popular tools chart
info

Tool usage distribution map

Tool usage distribution map
info

Associated diseases

Associated diseases

RNA Designer specifications

Information


Unique identifier OMICS_04751
Name RNA Designer
Alternative name RNA-SSD (RNA Secondary Structure Designer)
Interface Web user interface
Restrictions to use None
Computer skills Basic
Stability Stable
Maintained Yes

Publication for RNA Designer

RNA Designer in publications

 (12)
PMCID: 5897953
PMID: 29653577
DOI: 10.1186/s12951-018-0368-8

[…] rna molecules are yet to be classified. with the use of rna 2d structure prediction programme, only 70% of structure can be predicted accurately [, ]. though various online resources like mfold, 233 rna designer, 234 sfold, 235 nupack, 115 nanofolder, 236 and hyperfold, 182 have been developed, prediction of accurate rna structure and folding remains a major problem. rna 3d and 4d structure […]

PMCID: 5868141
PMID: 29581755
DOI: 10.7150/jca.22282

[…] la taq kit and subcloned into the lentiviral expression vector pwpxld (addgene plasmid #12258) using bamh1 and ecor1 restriction enzymes (neb). the foxg1 shrnas were designed using the block-it rna designer online tool (thermo fisher). the shfoxg1 sequences and scramble shrna sequence were subcloned into the pll3.7 lentiviral vector (shanghai cpg biotech co. ltd., shanghai) using xhoi […]

PMCID: 5488192
PMID: 28513846
DOI: 10.1111/nph.14599

[…] with the primers listed in supporting information table . to silence cml41, an artificial micro rna (amirna, 5′‐taaaccgtcatcatttgacca‐3′) was designed against the cml41 mrna sequence using web micro rna designer (wmd3, http://wmd3.weigelworld.org/cgi-bin/webapp.cgi) (schwab et al., ). whilst a 2‐kb sequence upstream from the cml41 atg start codon was amplified by pcr to represent the cml41 […]

PMCID: 5534949
PMID: 28463240
DOI: 10.1038/tp.2017.81

[…] all clone preparations were verified by sequencing the entire iqsec2 complementary dna (cdna)., four shrna sequences predicted to knock down mouse iqsec2 expression were designed using block-it rna designer (invitrogen, waltham, ma, usa). the sequences were chosen on the basis of species specificity and location within the messenger rna (mrna) transcript; shra (5′-ggaagttcagtcaccacatct-3′) […]

PMCID: 5333189
PMID: 28045501
DOI: 10.1021/acsnano.6b05737

[…] base pairing, leads to a variety of natural structural motifs., rna nanotechnology uses such properties to construct nanoparticles for use in nanomedicine and bionanotechnology applications., the rna designer can easily scan through varieties of rna secondary and tertiary structural motifs () (e.g., bulges, stems, hairpin, loops, and junctions). such motifs are used as building blocks […]


To access a full list of publications, you will need to upgrade to our premium service.

RNA Designer institution(s)
Department of Computer Science, University of British Columbia, Vancouver, BC, Canada

RNA Designer reviews

star_border star_border star_border star_border star_border
star star star star star

Be the first to review RNA Designer