SEPro statistics

info info

Citations per year

Number of citations per year for the bioinformatics software tool SEPro
info

Tool usage distribution map

This map represents all the scientific publications referring to SEPro per scientific context
info info

Associated diseases

This word cloud represents SEPro usage per disease context
info

Popular tool citations

chevron_left Peptide assignment validation chevron_right
Want to access the full stats & trends on this tool?

Protocols

SEPro specifications

Information


Unique identifier OMICS_27886
Name SEPro
Alternative name Search Engine Processor
Software type Application/Script
Interface Graphical user interface
Restrictions to use Academic or non-commercial use
Operating system Unix/Linux
Computer skills Medium
Stability Stable
Maintained No

Versioning


No version available

Maintainer


This tool is not available anymore.

Publication for Search Engine Processor

SEPro citations

 (23)
library_books

Embryonic stem cell derived cardiomyocytes for the treatment of doxorubicin induced cardiomyopathy

2018
PMCID: 5799903
PMID: 29402309
DOI: 10.1186/s13287-018-0788-2

[…] eavages, oxidation of methionine as variable and carbamidomethylation as fixed modifications, and a peptide tolerance of 40 ppm. The validity of the peptide sequence matches (PSMs) was assessed using Search Engine Processor version 2.2.0.2 (SEPro) software. A cutoff score was established to accept a false discovery rate (FDR) of 1% based on the number of decoys. A minimum sequence length of six am […]

library_books

Tick Host Range Adaptation: Changes in Protein Profiles in Unfed Adult Ixodes scapularis and Amblyomma americanum Saliva Stimulated to Feed on Different Hosts

2017
PMCID: 5742094
PMID: 29312895
DOI: 10.3389/fcimb.2017.00517

[…] atic modification. Data was searched with 50 ppm precursor ion tolerance and 20 ppm fragment ion tolerance.The validity of the peptide spectrum matches (PSMs) generated by ProLuCID was assessed using Search Engine Processor (SEPro) module from PatternLab for Proteomics platform (Carvalho et al., ). Identifications were grouped by charge state and tryptic status, resulting in four distinct subgroup […]

library_books

Construction of Mycobacterium tuberculosis cdd knockout and evaluation of invasion and growth in macrophages

2017
PMCID: 5661903
PMID: 29091140
DOI: 10.1590/0074-02760170105

[…] dundant M. tuberculosis reference proteome (ID UP000001584, www.uniprot.org) and the reverse sequences of all entries. The validity of the peptide spectra matches (PSMs) was assessed using the module Search Engine Processor (SEPro) from Patternlab for Proteomics, with a false discovery rate of 1%. Normalised spectral abundance factor (NSAF) was calculated according to , and data were evaluated wit […]

library_books

The EAL domain protein FcsR regulates flagella, chemotaxis and type III secretion system in Pseudomonas aeruginosa by a phosphodiesterase independent mechanism

2017
Sci Rep
PMCID: 5579053
PMID: 28860517
DOI: 10.1038/s41598-017-09926-3

[…] ty: fully-specific, missed cleavages: 1; variable modifications: methionine oxidation; fixed modifications: carbamidomethylation of cysteine. Peptide spectrum matches were filtered using PatternLab’s Search Engine Processor (SEPro) module to achieve a list of identifications with less than 1% of false discovery rate (FDR) at the protein level. Results were post-processed to only accept peptides wi […]

library_books

Platelet proteome reveals novel pathways of platelet activation and platelet mediated immunoregulation in dengue

2017
PLoS Pathog
PMCID: 5453622
PMID: 28542641
DOI: 10.1371/journal.ppat.1006385

[…] , respectively. The Comet search engine considered a precursor mass tolerance of 40 ppm and bins of 1.0005 for the MS/MS. The validity of the peptide spectrum matches were assessed using PatternLab’s Search Engine Processor (SEPro) module []. Identifications were grouped by charge state (+2 and > +3) and then by tryptic status (semi-tryptic), resulting in four distinct subgroups. For each result, […]

library_books

Adaptation of avian influenza virus to a swine host

2017
Virus Evol
PMCID: 5399929
PMID: 28458917
DOI: 10.1093/ve/vex007

[…] ntiTect Probe PCR kit in 20 µl reactions containing 10 µl 2× PCR master mix, 0.4 µM of each primer (Sep1: AGATGAGTCTTCTAACCGAGGTCG, Sep2b: TGCAAAG ACATCTTCAAGTCTCTG), 0.2 µM of a dual-labelled probe (SePRO: 6FAM-TCAGGCCCCCTCAAAGCCGA-BHQ1a), 2 µl of template cDNA, and RNAse-free water to 20 µl. These primers and probe [named after ()] were modified from a set described in () and were targeted at a […]


Want to access the full list of citations?
SEPro institution(s)
Laboratory for Toxinology, Oswaldo Cruz Institute, Rio de Janeiro, Brazil; Carlos Chagas Institute, Fiocruz, Paraná, Brazil; Department of Chemical Physiology, The Scripps Research Institute, La Jolla, CA, USA; Department of Biochemistry, University of Missouri, Columbia, USA; Systems Engineering and Computer Science Program, COPPE, Federal University of Rio de Janeiro, Rio de Janeiro, Brazil
SEPro funding source(s)
Supported by grants from Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES-Fiocruz 30/2006), The Fiocruz Center for Technological Development in Health (CDTS), Programa de Desenvolvimento Tecnológico em Insumos para Saúde (PDTIS-Fiocruz), Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq), BBP grants from Fundação Carlos Chagas Filho de Amparo à Pesquisa do Estado do Rio de Janeiro, National Institutes of Health (NIH R01 MH067880 and P41 RR011823).

SEPro reviews

star_border star_border star_border star_border star_border
star star star star star

Be the first to review SEPro