Sequencher protocols

Sequencher statistics

You need an account to access this content

info

Citations per year

Citations chart
info

Popular tool citations

chevron_left Read alignment Read quality control Sequence homology search Trace visualization/edition Sequence alignment Reference-assisted assembly SNV detection Base calling Methylation annotation Variant detection chevron_right
Popular tools chart
info

Tool usage distribution map

Tool usage distribution map
info

Associated diseases

Associated diseases

Sequencher specifications

Information


Unique identifier OMICS_01817
Name Sequencher
Software type Application/Script
Interface Graphical user interface
Restrictions to use License purchase required
Operating system Mac OS, Windows
License Commercial
Computer skills Medium
Version 5.4.6
Stability Stable
Maintained Yes

Versioning


Add your version

Documentation


Sequencher in pipelines

 (442)
2018
PMCID: 5796705
PMID: 29394269
DOI: 10.1371/journal.pone.0192060

[…] the qiagen pcr purification kit (qiagen) and sequenced using the sanger method (3130xl genetic analyzer; applied biosystems, foster city, ca, usa). sequences were assembled and manually edited using sequencher software version 5.0 (gene codes corporation, ann arbor, mi, usa). clustal x version 2.0 [] was used to align sequences, followed by manual editing using bioedit version 7.2.2 []. […]

2018
PMCID: 5849685
PMID: 29535379
DOI: 10.1038/s41467-018-03366-x

[…] of insertion of the ag-pul into the ancestral bu chromosome, the non-agarolytic strain bu atcc 8492 was used as a sequenced referenced genome. the genomes of each bacterium were compared using sequencher (ann arbor, mi). contigs that aligned with 60% sequence similarity over a 40 kbp region were gathered for further analysis. after aligning the genomes, it was observed that the deposited […]

2018
PMCID: 5852162
PMID: 29540836
DOI: 10.1038/s41598-018-22826-4

[…] cacaaacacccacagcatccga; b-r1: ggaaagaaggatactgatcctgcat) and f2/r2 were used to amplify and sequence the nucleotides of the f gene of rsv b samples. the sequences were edited and assembled by using sequencher software version 5.0 (gene codes, ann arbor, mi, usa). the sequences generated in this study were submitted to genbank with the accession numbers from mf978510 to mf978761., all (140) […]

2018
PMCID: 5859231
PMID: 29593755
DOI: 10.3389/fpls.2018.00283

[…] numbers listed in supplementary table . the electropherograms obtained for each region were base-called using phred vii (). the proofreading of sequencing peaks and contig assembly were done in sequencher v5.4.6 (gene codes corporation, ann arbor, mi, united states). finally, the contigs were analyzed through ncbi blastn 2.2.1+ (; ) and loaded on to bold using identification request […]

2018
PMCID: 5859447
PMID: 29558885
DOI: 10.1186/s12879-018-3014-z

[…] was performed in both directions using the amplification primers with the abi prism® bigdye™ terminator cycle sequencing ready reaction kit ver. 3.1 on an abi 3100 dna sequencer (thermoficher). sequencher™ 3.1.1 software (gene codes, annarbor, mi) was used for sequence assembly and editing. for some hadv positive specimens that could not be accurately typed by partial hexon gene sequencing, […]

Sequencher in publications

 (2673)
PMCID: 5950187
PMID: 29754586
DOI: 10.1186/s12898-018-0171-2

[…] negative samples for bird dna (for cyt-b gene) following dumbacher et al. []. the resulting pcr products were then sequenced in both directions. sequences were assembled, aligned and edited using sequencher version 5.2 (genecodes corp., ann arbor, mi, usa). we then identified sequences to genus using their closest sequence matches in the genbank or malavi databases []. for each positive pcr […]

PMCID: 5931452
PMID: 29718994
DOI: 10.1371/journal.pone.0195811

[…] using agarose gel electrophoresis and sequencing was served by the sangon biotech (shanghai) co., ltd., using the same primers for pcr amplifications., sequences were assembled and edited using sequencher v.4.5 (gene codes corporation, ann arbor, michigan, u.s.a.). sequence alignment was initially conducted in clustal x v.2.0. [] and adjusted manually in bioedit sequence alignment editor […]

PMCID: 5932885
PMID: 29720182
DOI: 10.1186/s12944-018-0763-z

[…] 50 bp of flanking intronic sequences at each exon-intron boundary were amplified by polymerase chain reaction. primer sequences are available upon request. sequences were analyzed using sequencher (genecodes) and compared to the human ldlr reference sequence (genome reference consortium human build 38 patch release 7 (grch38.p7), nm_000527.4). all the identified variants […]

PMCID: 5928099
PMID: 29712903
DOI: 10.1038/s41467-018-04041-x

[…] kit, applied biosystems)., raw sequence data were quality controlled and vector ends were trimmed, then forward and reverse amplicons were assembled into near-full-length 16s rrna contigs using sequencher 4.6 software (gene codes corporation, ann arbor, mi). the 16s rrna contigs were aligned with the sina aligner, and then imported into silvaref115 curated 16s rrna reference database using […]

PMCID: 5922010
PMID: 29699577
DOI: 10.1186/s12985-018-0990-y

[…] orientation and q8, pv10a, pv1a and 253a (3.2 picomole/μl) for the antisense orientation []. the samples were then run on the abi 3130xl genetic analyzer and sequenced. the data were analyzed using sequencher software v4.10.1. finally, the alignment of the sequence data and the inference of phylogenetic relatedness was performed using the mega version 7.0 software []. the obtained sequences […]

Sequencher institution(s)
Gene Codes Corporation

Sequencher reviews

star_border star_border star_border star_border star_border
star star star star star

Be the first to review Sequencher