siDirect specifications

Information


Unique identifier OMICS_04739
Name siDirect
Interface Web user interface
Restrictions to use Academic or non-commercial use
Input data An accession number or a nucleotide sequence.
Programming languages Perl
Computer skills Basic
Version 2.0
Stability Stable
Maintained Yes

Maintainers


  • person_outline Shinichi Morishita <>
  • person_outline Kumiko Ui-Tei <>
  • person_outline Yuki Naito <>
  • person_outline Jun Yoshimura <>

Additional information


http://sidirect2.rnai.jp/doc/

Publications for siDirect

siDirect in publications

 (81)
PMCID: 5877948
PMID: 29463761
DOI: 10.1073/pnas.1719493115

[…] were conducted as described previously (). pv11 rna-seq data generated for this study have been deposited to the ncbi sra under accession number srp070984., hsf gene sirnas were designed using sidirect (). the uniqueness of each candidate sirna was confirmed by blast search of the p. vanderplanki genome (midgebase: bertone.nises-f.affrc.go.jp/midgebase) to minimize off-target effects. […]

PMCID: 5891197
PMID: 28940965
DOI: 10.1111/cas.13403

[…] complex was detected using a peroxidase‐conjugated secondary antibody and ecl system (amersham) according to the manufacturer's instructions., all sirna oligonucleotide sequences were designed using sidirect software and the oligonucleotide sets used in this study are shown in table . uc cells were incubated with complete medium until confluence reached 50%‐60%, then uc cells were transfected […]

PMCID: 5799248
PMID: 29403024
DOI: 10.1038/s41598-018-20258-8

[…] and 5′-gcgcggccgccggctgatgcaag-3′ were for psicheck-2-crkl-3′-utr-mut2., for crkl knockdown, targeting shrnas were designed according to crkl sequence (genbank: nm_005207.3) using invitrogen, sidirect and whitehead software. out of three crkl-specific shrna double-stranded oligodeoxyribonucleotides, the optimal shrna for crkl knockdown was with the sense and antisense sequences […]

PMCID: 5785806
PMID: 29370752
DOI: 10.1186/s12862-018-1124-2

[…] (roche, basel, switzerland) using cdna as a template. primers used are listed in additional file : table s1. the detailed procedures are described in additional file ., sirnas were designed using sidirect version 2.0 [] (additional file : table s2), and chemically synthesized and annealed (fasmac, atsugi, japan). the electroporation-mediated rnai was conducted as described previously []. […]

PMCID: 5798889
PMID: 29423269
DOI: 10.1038/s41421-017-0001-2

[…] virus was collected, concentrated with the lenti-x concentrator (takara bio), and used to infect a549 cells and mda-231-d cells., rnai was carried out with the following sirnas designed from sidirect (rnai inc.) (5′→3′): human tuft1#1, ggauauaaguagcaagcuuga and aagcuugcuacuuauauccuc; human tuft1#2, guagccuuuugcggaaaaauu and uuuuuccgcaaaaggcuacuc; human mtor#1, gaucucaugggcuucggaaca […]


To access a full list of publications, you will need to upgrade to our premium service.

siDirect institution(s)
Department of Biophysics and Biochemistry, Graduate School of Science, University of Tokyo, Tokyo, Japan; Department of Computational Biology, Graduate School of Frontier Sciences, University of Tokyo, Chiba, Japan
siDirect funding source(s)
Supported by grants from the Ministry of Education, Culture, Sports, Science and Technology (MEXT) of Japan.

siDirect reviews

star_border star_border star_border star_border star_border
star star star star star

Be the first to review siDirect