siDirect statistics

Tool stats & trends

Looking to identify usage trends or leading experts?

Protocols

siDirect specifications

Information


Unique identifier OMICS_04739
Name siDirect
Interface Web user interface
Restrictions to use Academic or non-commercial use
Input data An accession number or a nucleotide sequence.
Programming languages Perl
Computer skills Basic
Version 2.0
Stability Stable
Maintained Yes

Maintainers


  • person_outline Shinichi Morishita
  • person_outline Kumiko Ui-Tei
  • person_outline Yuki Naito
  • person_outline Jun Yoshimura

Additional information


http://sidirect2.rnai.jp/doc/

Publications for siDirect

siDirect citations

 (83)
call_split

Cooption of heat shock regulatory system for anhydrobiosis in the sleeping chironomid Polypedilum vanderplanki

2018
Proc Natl Acad Sci U S A
PMCID: 5877948
PMID: 29463761
DOI: 10.1073/pnas.1719493115
call_split See protocol

[…] Hsf gene siRNAs were designed using siDirect (). The uniqueness of each candidate siRNA was confirmed by BLAST search of the P. vanderplanki genome (MidgeBase: bertone.nises-f.affrc.go.jp/midgebase) to minimize off-target effects. All d […]

library_books

Epirubicin suppresses proliferative and metastatic potential by downregulating transforming growth factor‐β‐induced expression in urothelial carcinoma

2018
Cancer Sci
PMCID: 5891197
PMID: 28940965
DOI: 10.1111/cas.13403

[…] All siRNA oligonucleotide sequences were designed using siDirect software and the oligonucleotide sets used in this study are shown in Table . UC cells were incubated with complete medium until confluence reached 50%‐60%, then UC cells were transfected wit […]

library_books

miR 429 suppresses tumor migration and invasion by targeting CRKL in hepatocellular carcinoma via inhibiting Raf/MEK/ERK pathway and epithelial mesenchymal transition

2018
Sci Rep
PMCID: 5799248
PMID: 29403024
DOI: 10.1038/s41598-018-20258-8

[…] CGAGTG-3′ and 5′-GCGCGGCCGCCGGCTGATGCAAG-3′ were for psiCHECK-2-CRKL-3′-UTR-MUT2.For CRKL knockdown, targeting shRNAs were designed according to CRKL sequence (Genbank: NM_005207.3) using Invitrogen, siDirect and Whitehead software. Out of three CRKL-specific shRNA double-stranded oligodeoxyribonucleotides, the optimal shRNA for CRKL knockdown was with the sense and antisense sequences of 5′-GTCAC […]

library_books

The pivotal role of aristaless in development and evolution of diverse antennal morphologies in moths and butterflies

2018
BMC Evol Biol
PMCID: 5785806
PMID: 29370752
DOI: 10.1186/s12862-018-1124-2

[…] siRNAs were designed using siDirect version 2.0 [] (Additional file : Table S2), and chemically synthesized and annealed (Fasmac, Atsugi, Japan). The electroporation-mediated RNAi was conducted as described previously []. In br […]

library_books

TUFT1 interacts with RABGAP1 and regulates mTORC1 signaling

2018
PMCID: 5798889
PMID: 29423269
DOI: 10.1038/s41421-017-0001-2

[…] RNAi was carried out with the following siRNAs designed from siDirect (RNAi inc.) (5′→3′): Human TUFT1#1, GGAUAUAAGUAGCAAGCUUGA and AAGCUUGCUACUUAUAUCCUC; Human TUFT1#2, GUAGCCUUUUGCGGAAAAAUU and UUUUUCCGCAAAAGGCUACUC; Human mTOR#1, GAUCUCAUGGGCUUCGGAACA and UU […]

library_books

Mitochondrial intermediate peptidase is a novel regulator of sirtuin‐3 activation by caloric restriction

2017
FEBS Lett
PMCID: 5767765
PMID: 29151261
DOI: 10.1002/1873-3468.12914

[…] details of which were published in our previous study .The pMXs‐puro‐mU6 vector was constructed as previously reported . A mouse shRNA against the Mipep (shMipep) expression vector was designed using siDirect 2.0 (http://siDirect2.RNAi.jp/). Sequences of oligonucleotides for shMipep and shGFP (used as a negative control) were as follows: shMipep (5′‐GTG ATG AGA AGT TTA TGG GGT TTC AAG AGA ACT CCA […]

Citations

Looking to check out a full list of citations?

siDirect institution(s)
Department of Biophysics and Biochemistry, Graduate School of Science, University of Tokyo, Tokyo, Japan; Department of Computational Biology, Graduate School of Frontier Sciences, University of Tokyo, Chiba, Japan
siDirect funding source(s)
Supported by grants from the Ministry of Education, Culture, Sports, Science and Technology (MEXT) of Japan.

siDirect reviews

star_border star_border star_border star_border star_border
star star star star star

Be the first to review siDirect