Sim3C statistics

To access cutting-edge analytics on consensus tools, life science contexts and associated fields, you will need to subscribe to our premium service.

Subscribe
info

Citations per year

Citations chart
info

Popular tool citations

chevron_left Data simulation chevron_right
Popular tools chart
info

Tool usage distribution map

Tool usage distribution map
info

Associated diseases

Associated diseases

Sim3C specifications

Information


Unique identifier OMICS_18424
Name Sim3C
Software type Package/Module
Interface Command line interface
Restrictions to use None
Input data A community profile, some genomic sequences, an enzyme.
Operating system Unix/Linux, Mac OS, Windows
Programming languages Python
License GNU General Public License version 3.0
Computer skills Advanced
Stability Stable
Requirements
biopython, intervaltree, numpy, scipy, tqdm, PyYAML
Maintained Yes

Download


Versioning


Add your version

Maintainer


  • person_outline Matthew DeMaere <>

Publication for Sim3C

Sim3C in publication

PMCID: 5170611
PMID: 27733621
DOI: 10.1091/mbc.E16-06-0346

[…] sixty thousand u2os cells were plated into each well of a six-well plate and cultured under standard growth conditions overnight. the following day, cells were transfected with 1 μl sim3n, sim3c or scrambled sirna oligos (all at 20-μm stock solutions) using hiperfect transfection reagent (qiagen, hilden, germany). sim3n and sim3c were 5′gucauuccagcagucaucuuu3′ […]


To access a full list of publications, you will need to upgrade to our premium service.

Sim3C institution(s)
The ithree institute, University of Technology Sydney, Sydney, NSW, Australia
Sim3C funding source(s)
Supported by Australian Research Council’s Discovery Projects funding scheme (project number: LP15010091).

Sim3C reviews

star_border star_border star_border star_border star_border
star star star star star

Be the first to review Sim3C