siSearch statistics

To access cutting-edge analytics on consensus tools, life science contexts and associated fields, you will need to subscribe to our premium service.

Subscribe
info

Citations per year

Citations chart
info

Popular tool citations

chevron_left RNAi reagent design chevron_right
Popular tools chart
info

Tool usage distribution map

Tool usage distribution map
info

Associated diseases

Associated diseases

siSearch specifications

Information


Unique identifier OMICS_27388
Name siSearch
Interface Web user interface
Restrictions to use None
Programming languages Java
Computer skills Basic
Maintained No

Information


Unique identifier OMICS_27388
Name siSearch
Software type Application/Script
Interface Command line interface
Restrictions to use None
Operating system Unix/Linux
Programming languages Java
Computer skills Advanced
Requirements
BioJava, Java Runtime Environment
Maintained No

Versioning


Add your version

Publication for siSearch

siSearch in publications

 (3)
PMCID: 4468906
PMID: 26051838
DOI: 10.1038/ncomms8378

[…] among other tools and websites, we used also genscript's sirna design center (www.genscript.com/design_center.html), sisearch (sidirect2.rnai.jp/), idt scitools rnai design (http://sg.idtdna.com/scitools/applications/rnai/rnai.aspx/), target finder supplied by ambion […]

PMCID: 4491608
PMID: 25821946
DOI: 10.1038/oncsis.2015.1

[…] and 5′-gcatcttctgctggaaggtc-3′ (reverse)., two pairs of hairpin sirna template oligonucleotides for rap1 based on psilencer3.1-h1 vector (ambion, austin, tx, usa) were designed by sisearch. oligo-1:, 5′-gatccgtgtagctcggaggattgaattcaagagattcaatcctccgagctaca ttttttggaaa-3′ and 5′-agcttttccaaaaaatgtagctcggaggattgaatctcttgaattcaatcctccgagctacacg-3′. oligo-2: […]

PMCID: 2949395
PMID: 20957177
DOI: 10.1371/journal.pone.0013177

[…] in this study comprise most of the nearly 1,000 sense-antisense transcript pairs, conserved between human and mouse , originally identified through the fantom3 transcriptomics effort. we used sisearch to rank all possible sirnas targeting antisense transcripts of the ∼1000 nat pairs. we then selected high scoring sirnas and tested these for specificity, using a wu-blast search […]


To access a full list of publications, you will need to upgrade to our premium service.

siSearch institution(s)
Center for Genomics and Bioinformatics, Karolinska Institutet, Stockholm, Sweden
siSearch funding source(s)
Supported by a grant from Pfizer Inc.

siSearch reviews

star_border star_border star_border star_border star_border
star star star star star

Be the first to review siSearch