siSearch statistics

info info

Citations per year

Number of citations per year for the bioinformatics software tool siSearch
info

Tool usage distribution map

info info

Associated diseases

info

Popular tool citations

chevron_left RNAi reagent design chevron_right
Want to access the full stats & trends on this tool?

Protocols

siSearch specifications

Information


Unique identifier OMICS_27388
Name siSearch
Interface Web user interface
Restrictions to use None
Programming languages Java
Computer skills Basic
Maintained No

Information


Unique identifier OMICS_27388
Name siSearch
Software type Application/Script
Interface Command line interface
Restrictions to use None
Operating system Unix/Linux
Programming languages Java
Computer skills Advanced
Requirements
BioJava, Java Runtime Environment
Maintained No

Versioning


No version available

Publication for siSearch

siSearch citations

 (3)
call_split

Effective heritable gene knockdown in zebrafish using synthetic microRNAs

2015
Nat Commun
PMCID: 4468906
PMID: 26051838
DOI: 10.1038/ncomms8378
call_split See protocol

[…] nologies.com/rnaiexpress/setOption.do?designOption=mirna&pid=8945441149181672314). Among other tools and websites, we used also GenScript's siRNA Design Center (www.genscript.com/design_center.html), siSearch (sidirect2.rnai.jp/), IDT SciTools RNAi Design (http://sg.idtdna.com/Scitools/Applications/RNAi/RNAi.aspx/), Target Finder supplied by Ambion (http://www.ambion.com/techlib/misc/siRNA_finder. […]

library_books

Rap1 is indispensable for TRF2 function in etoposide induced DNA damage response in gastric cancer cell line

2015
Oncogenesis
PMCID: 4491608
PMID: 25821946
DOI: 10.1038/oncsis.2015.1

[…] Two pairs of hairpin siRNA template oligonucleotides for Rap1 based on pSilencer3.1-H1 vector (Ambion, Austin, TX, USA) were designed by siSearch. Oligo-1:5′-GATCCGTGTAGCTCGGAGGATTGAATTCAAGAGATTCAATCCTCCGAGCTACA TTTTTTGGAAA-3′ and 5′-AGCTTTTCCAAAAAATGTAGCTCGGAGGATTGAATCTCTTGAATTCAATCCTCCGAGCTACACG-3′. Oligo-2: 5′-GATCCGTTGGATGTATTTACAG […]

library_books

RNAi Screen Indicates Widespread Biological Function for Human Natural Antisense Transcripts

2010
PLoS One
PMCID: 2949395
PMID: 20957177
DOI: 10.1371/journal.pone.0013177

[…] xamined in this study comprise most of the nearly 1,000 sense-antisense transcript pairs, conserved between human and mouse , originally identified through the FANTOM3 transcriptomics effort. We used siSearch to rank all possible siRNAs targeting antisense transcripts of the ∼1000 NAT pairs. We then selected high scoring siRNAs and tested these for specificity, using a wu-blast search against the […]


Want to access the full list of citations?
siSearch institution(s)
Center for Genomics and Bioinformatics, Karolinska Institutet, Stockholm, Sweden
siSearch funding source(s)
Supported by a grant from Pfizer Inc.

siSearch reviews

star_border star_border star_border star_border star_border
star star star star star

Be the first to review siSearch