siSearch statistics

Tool stats & trends

Looking to identify usage trends or leading experts?

Protocols

siSearch specifications

Information


Unique identifier OMICS_27388
Name siSearch
Interface Web user interface
Restrictions to use None
Programming languages Java
Computer skills Basic
Maintained No

Information


Unique identifier OMICS_27388
Name siSearch
Software type Application/Script
Interface Command line interface
Restrictions to use None
Operating system Unix/Linux
Programming languages Java
Computer skills Advanced
Requirements
BioJava, Java Runtime Environment
Maintained No

Versioning


No version available

Publication for siSearch

siSearch citations

 (3)
call_split

Effective heritable gene knockdown in zebrafish using synthetic microRNAs

2015
Nat Commun
PMCID: 4468906
PMID: 26051838
DOI: 10.1038/ncomms8378
call_split See protocol

[…] nologies.com/rnaiexpress/setOption.do?designOption=mirna&pid=8945441149181672314). Among other tools and websites, we used also GenScript's siRNA Design Center (www.genscript.com/design_center.html), siSearch (sidirect2.rnai.jp/), IDT SciTools RNAi Design (http://sg.idtdna.com/Scitools/Applications/RNAi/RNAi.aspx/), Target Finder supplied by Ambion (http://www.ambion.com/techlib/misc/siRNA_finder. […]

library_books

Rap1 is indispensable for TRF2 function in etoposide induced DNA damage response in gastric cancer cell line

2015
Oncogenesis
PMCID: 4491608
PMID: 25821946
DOI: 10.1038/oncsis.2015.1

[…] Two pairs of hairpin siRNA template oligonucleotides for Rap1 based on pSilencer3.1-H1 vector (Ambion, Austin, TX, USA) were designed by siSearch. Oligo-1:5′-GATCCGTGTAGCTCGGAGGATTGAATTCAAGAGATTCAATCCTCCGAGCTACA TTTTTTGGAAA-3′ and 5′-AGCTTTTCCAAAAAATGTAGCTCGGAGGATTGAATCTCTTGAATTCAATCCTCCGAGCTACACG-3′. Oligo-2: 5′-GATCCGTTGGATGTATTTACAG […]

library_books

RNAi Screen Indicates Widespread Biological Function for Human Natural Antisense Transcripts

2010
PLoS One
PMCID: 2949395
PMID: 20957177
DOI: 10.1371/journal.pone.0013177

[…] xamined in this study comprise most of the nearly 1,000 sense-antisense transcript pairs, conserved between human and mouse , originally identified through the FANTOM3 transcriptomics effort. We used siSearch to rank all possible siRNAs targeting antisense transcripts of the ∼1000 NAT pairs. We then selected high scoring siRNAs and tested these for specificity, using a wu-blast search against the […]

Citations

Looking to check out a full list of citations?

siSearch institution(s)
Center for Genomics and Bioinformatics, Karolinska Institutet, Stockholm, Sweden
siSearch funding source(s)
Supported by a grant from Pfizer Inc.

siSearch reviews

star_border star_border star_border star_border star_border
star star star star star

Be the first to review siSearch