skewer protocols

skewer specifications

Information


Unique identifier OMICS_02106
Name skewer
Software type Package/Module
Interface Command line interface
Restrictions to use None
Biological technology Illumina
Operating system Unix/Linux
Programming languages C++
Computer skills Advanced
Stability Stable
Maintained Yes

Download


Versioning


Add your version

Documentation


Publication for skewer

skewer IN pipelines

 (5)
2017
PMCID: 5708109
PMID: 29187174
DOI: 10.1186/s12885-017-3815-2

[…] was performed using autoseq (https://github.com/clinseq/autoseq), using the same pre-processing procedure as described previously [10]. in brief, standard illumina adapters were trimmed using skewer version 0.1.117 [25] with default parameters. alignment was carried out using star aligner version 2.4.0e [26] and gene expression estimates were calculated with htseq count version 0.6.1 […]

2017
PMCID: 5829565
PMID: 29253221
DOI: 10.1093/nar/gkx1263

[…] the amplified products were subjected to 50 bp single-end sequencing on an illumina hiseq 2500 and subjected to our analysis pipeline. the reads are first trimmed of the 3′ adaptor using the skewer package (60). the n7 randomized nucleotides from our ligated adaptor were trimmed from read 5′ ends using fastx_trimmer (http://hannonlab.cshl.edu/fastx_toolkit/index.html by hannon lab). […]

2016
PMCID: 4735337
PMID: 26830453
DOI: 10.1038/srep20200

[…] dataset, including pam50 features only and named it pam50 dataset37., standard illumina adapters (agatcggaagagcacacgtctgaactccagtcac and agatcggaagagcgtcgtgtagggaaagagtgta) were trimmed using skewer version-0.1.11738 with default parameters. alignment was carried out using star aligner version-2.4.0e39 with the following parameters: “–outsammapqunique 50”, to set the maximum alignment […]

2016
PMCID: 5033589
PMID: 27658249
DOI: 10.1371/journal.pone.0163235

[…] were used for each strain in each condition. polya-selected library preparation and rna-seq was carried out by bgi (www.genomics.cn/en) using illumina hiseq2500. raw rna-seq reads were trimmed using skewer v0.1.117 and aligned to the respective cgob genome using tophat2 v2.0.12 [54, 55]. aligned rna-seq data was visualized using jbrowse v1.11.2 [56]. raw rna-seq data is available at the ncbi […]

2016
PMCID: 5363413
PMID: 28325279
DOI: 10.1016/j.omtn.2016.12.001

[…] python (2.7.2), and shell programming languages in order to orchestrate the delivery of the intermediate results to the pipeline tools and to complete customized operations on tabular files. skewer29 has been used for the trimming of adapters, and samtools is employed for the intermediate processing of sam alignment files along with our perl and shell scripts. to make gene-is usable […]

skewer institution(s)
Institute of Plant Quarantine Research, Chinese Academy of Inspection and Quarantine, Huixinli, Beijing, China

skewer review

star_border star_border star_border star_border star_border
star star star star star

Fabien Pichon

star_border star_border star_border star_border star_border
star star star star star
Desktop
The best trimmer I used so far because it takes indels into account, which is not the case for most of trimmers. Furthermore you can specify a ratio for mismatches and indels separately, which is very smart. I recommend !