TargetSearch protocols

View TargetSearch computational protocol

TargetSearch statistics

To access cutting-edge analytics on consensus tools, life science contexts and associated fields, you will need to subscribe to our premium service.

Subscribe
info

Citations per year

Citations chart
info

Popular tool citations

chevron_left Metabolite identification Noise filtering Spectral deconvolution Peak detection Spectral visualization Chromatogram alignment Metabolite identification Peak detection Spectral visualization Spectral deconvolution Peak alignment chevron_right
Popular tools chart
info

Tool usage distribution map

Tool usage distribution map
info

Associated diseases

Associated diseases

TargetSearch specifications

Information


Unique identifier OMICS_09688
Name TargetSearch
Software type Package/Module
Interface Command line interface
Restrictions to use None
Operating system Unix/Linux, Mac OS, Windows
Programming languages C, R
License GNU General Public License version 2.0
Computer skills Advanced
Version 1.2.0
Stability Stable
Requirements
methods, R(>=2.7.0), tcltk, xcms, TargetSearchData
Maintained Yes

Versioning


Add your version

Documentation


Maintainer


  • person_outline Matthew A. Hannah <>

Publication for TargetSearch

TargetSearch in pipeline

2010
PMCID: 3015162
PMID: 21289855
DOI: 10.1007/s12566-010-0015-9

[…] solutions for the analysis of gc-ms and lc-ms exist []. that includes leco chromatof, spectralworks analyzerpro, ion signature quantitative deconvolution software, highchem massfrontier, and targetsearch []. the use of peak picking and peak detection algorithms for lc-ms data [, ] is still an active field of research due to high noise ratios, broader chromatographic peaks, and mass […]


To access a full list of citations, you will need to upgrade to our premium service.

TargetSearch in publications

 (26)
PMCID: 5698474
PMID: 29162853
DOI: 10.1038/s41598-017-15607-y

[…] tissues and cancer cell lines.figure 1 , to further understand molecular mechanism of mir-152 in breast cancer cells, several well-developed mirna algorithms, such as targetscan, mirnapath, and targetsearch, were employed to obtain a list of possible mrna targets of mir-152. as a potential mir-152 binding site was predicted within the 3′-utr of β-catenin mrna, we constructed the 3′utr […]

PMCID: 5499862
PMID: 28520864
DOI: 10.1093/gigascience/gix037

[…] an interactive user interface facilitating use by unexperienced users. they do, however, require several manual input and data check steps that are time consuming and negate truly high throughput. targetsearch [] uses similar approaches to process data and identify and quantify targeted metabolites based on retention time index and spectra-matching of multiple correlated masses, […]

PMCID: 5220112
PMID: 28119698
DOI: 10.3389/fpls.2016.01954

[…] range. after acquisition, chromatogram files were converted to netcdf for further processing., mass chromatographic features were extracted with xcms (smith et al., ) and subsequently processed with targetsearch software (cuadros-inostroza et al., ) using golm metabolite database (available from http://www.mpimp-golm.mpg.de/). briefly, this software calculates ri for all compounds […]

PMCID: 5154533
PMID: 27959937
DOI: 10.1371/journal.pone.0167941

[…] (taggttgagcgactcccactg) would not attenuate the expression of other unintended sequences using the target search provided by the wmd3 website (http://wmd3.weigelworld.org/cgi-bin/webapp.cgi?page=targetsearch;project=stdwmd), allowing for 5 mismatches., the pcambia1305.1:mirbdiri construct was transformed into agrobacterium strain agl1 (invitrogen) using electroporation and subsequently […]

PMCID: 5070769
PMID: 27760136
DOI: 10.1371/journal.pgen.1006363

[…] used []. chromatograms were exported from leco chromatof software (version 3.34) to r software. ion extraction, peak detection, retention time alignment and library searching were obtained using the targetsearch package from bioconductor []. day-normalization and sample median-normalization were conducted; the resulting data matrix was used for further analysis., 200k snp data for 314 a. […]


To access a full list of publications, you will need to upgrade to our premium service.

TargetSearch institution(s)
Max Planck Institute of Molecular Plant Physiology, Am Mühlenberg 1, Potsdam-Golm, Germany; Centro de Biotecnología, Universidad Técnica Federico Santa María, Chile; RIKEN Plant Science Center, Tsurumi-ku, Suehiro-cho, Kanagawa, Japan; Bayer BioScience N.V., Technologiepark 38, Gent, Belgium

TargetSearch reviews

star_border star_border star_border star_border star_border
star star star star star

Be the first to review TargetSearch