TriageTools protocols

View TriageTools computational protocol

TriageTools statistics

To access cutting-edge analytics on consensus tools, life science contexts and associated fields, you will need to subscribe to our premium service.

Subscribe
info

Citations per year

Citations chart
info

Popular tool citations

chevron_left File splitting chevron_right
Popular tools chart
info

Tool usage distribution map

Tool usage distribution map
info

Associated diseases

Associated diseases

TriageTools specifications

Information


Unique identifier OMICS_04587
Name TriageTools
Software type Toolkit/Suite
Interface Command line interface
Restrictions to use None
Input format FASTQ
Output format FASTQ
Operating system Unix/Linux
Programming languages Java
License Apache License version 2.0
Computer skills Advanced
Version 0.2.2
Stability Stable
Maintained Yes

Download


Versioning


Add your version

Maintainer


  • person_outline Vincent Detours <>

Additional information


https://sourceforge.net/p/triagetools/wiki/Home/

Publication for TriageTools

TriageTools in pipeline

2016
PMCID: 5164930
PMID: 27820796
DOI: 10.1038/nchembio.2226

[…] v3 chemistry. raw sequencing data is available from ena under accession number erp014134., reads were trimmed of adapter sequences using cutadapt (v.1.2.1). high-quality reads were extracted using triagetools (v0.2.2, long reads –length 35, high-quality bases –quality 9, and complex sequences –lzw 0.33). alignments onto the mm10 genome were carried out using gsnap (v2014-02-28) with gencode […]


To access a full list of citations, you will need to upgrade to our premium service.

TriageTools in publications

 (2)
PMCID: 5119491
PMID: 27482057
DOI: 10.15252/msb.20166890

[…] western lightning plus‐ecl (perkinelmer)., unaligned reads in fastq format were trimmed of adapter sequence agatcggaagagcacacgtctgaactccagtcac using cutadapt (v.1.2.1) and then partitioned using triagetools (fimereli et al, ) (v0.2.2) to select long (–length 35), high‐quality (–quality 9), and sequence‐complex (–lzw 0.33) reads. selected reads were aligned using gsnap (wu & nacu, ; […]

PMCID: 4374178
PMID: 25884932
DOI: 10.1186/s12885-015-1176-2

[…] and an e-value of e-05) against the refseq viral database. contigs with a viral hit were further aligned against the nt database and analyzed as in the two previous steps., in pipeline 4 we used triagetools [] (v0.2.0), a tool that efficiently screens input reads for similarity to a specific target sequence. triagetools was utilized with default parameters, the raw reads as input […]


To access a full list of publications, you will need to upgrade to our premium service.

TriageTools institution(s)
IRIBHM, Universite Libre de Bruxelles, Brussels, Belgium; Welbio, Universite Libre de Bruxelles, Brussels, Belgium
TriageTools funding source(s)
Supported by TeleVie grant from the Belgian FNRS.

TriageTools reviews

star_border star_border star_border star_border star_border
star star star star star

Be the first to review TriageTools