UniPrimer statistics

Tool stats & trends

Looking to identify usage trends or leading experts?

Protocols

UniPrimer specifications

Information


Unique identifier OMICS_23029
Name UniPrimer
Interface Web user interface
Restrictions to use None
Computer skills Basic
Stability Stable
Maintained No

Maintainers


This tool is not available anymore.

Publication for UniPrimer

UniPrimer citations

 (26)
library_books

In vitro significance of SOCS 3 and SOCS 4 and potential mechanistic links to wound healing

2017
Sci Rep
PMCID: 5532239
PMID: 28751715
DOI: 10.1038/s41598-017-06886-6

[…] ief, primers were designed specifically to SOCS-3 and SOCS-4 (Table ). To the reverse primer of each pair a Z sequence (ACTGAACCTGACCGTACA) was added in order to allow incorporation of the FAM tagged Uniprimer probe (Intergen Inc., New York, USA) and subsequent fluorescent detection. An internal standard was run alongside the genes of interest and used to generate a standard curve, allowing relati […]

library_books

Reduced NOV expression correlates with disease progression in colorectal cancer and is associated with survival, invasion and chemoresistance of cancer cells

2017
Oncotarget
PMCID: 5432252
PMID: 28412738
DOI: 10.18632/oncotarget.15439

[…] g RNA using a reverse transcription kit (BioRad, UK). NOV mRNA expression in CRC tissues was determined using real time PCR and an Ampliflor™-based PCR method, in which a 6-carboxy-fluorescine-tagged Uniprimer™ (Biosearch Technologies, Inc.) was used as a probe together with a pair of target specific primers. The reverse primer contained a Z-sequence (actgaacctgaccgtaca) which is complimentary to […]

library_books

NHERF1 regulates the progression of colorectal cancer through the interplay with VEGFR2 pathway

2016
Oncotarget
PMCID: 5352358
PMID: 27999191
DOI: 10.18632/oncotarget.13949

[…] t (Sigma, St. Louis, MO, USA). Quantitative analysis of NHERF1 mRNA expression in colorectal tissues was determined by QPCR using Amplifor™-based technologies, in which a 6-carboxy-fluorescine-tagged Uniprimer™ (Biosearch Technologies, Inc., Petaluma, CA, USA) was used as a probe together with a pair of target-specific primers and reverse primer with an additional Z-sequence (actgaacctgaccgtaca) ( […]

library_books

Complement inhibitor CSMD1 acts as tumor suppressor in human breast cancer

2016
Oncotarget
PMCID: 5363559
PMID: 27764775
DOI: 10.18632/oncotarget.12729

[…] ted, quantified and subjected to a reverse transcription kit (PrimerDesign). Quantification of the CSMD1 and the house keeping actin transcripts were carried using the Ampliflor technology in which a uniprimer with a Z-sequence (underlined in the following) was used as a probe. The primer sequence for CSMD1 and actin were respectively (5′ - 3′): aggagatgagaggccaag vs actgaacctgaccgtacaccccataaactg […]

call_split

Expression of the SOCS family in human chronic wound tissues: Potential implications for SOCS in chronic wound healing

2016
PMCID: 5065297
PMID: 27635428
DOI: 10.3892/ijmm.2016.2733
call_split See protocol

[…] amily members using the Beacon Designer software (Bio-Rad, Hercules, CA, USA). A Z sequence was added to one of each of the primer pairs (ACTGAACCTGACCGTACA), to allow incorporation of the FAM tagged UniPrimer probe (Intergen, Inc., New York, NY, USA) and thus fluorescent detection. Expression of the target sequence was detected in conjunction with an internal standard used to generate a standard […]

library_books

Differential expression of CCN family members CYR611, CTGF and NOV in gastric cancer and their association with disease progression

2016
PMCID: 5055206
PMID: 27633176
DOI: 10.3892/or.2016.5074

[…] A synthesis kit (Bio-Rad, Hemel Hempstead, UK). Quantitative analysis of NOV mRNA expression in GC tissues was performed using Amplifluor™-based real-time PCR, in which a 6-carboxy-fluorescine-tagged Uniprimer™ (Biosearch Technologies, Inc.) was used as a probe along with a pair of specific primers with an addition of a Z-sequence (actgaacctgaccgtaca) to the 5′-end of the reverse primer. The quali […]

Citations

Looking to check out a full list of citations?

UniPrimer institution(s)
Department of Nanobiomedical Science and WCU Research Center, Dankook University, Cheonan, Korea; Department of Clinical Laboratory Science, Juseong University, Cheongwon, Korea
UniPrimer funding source(s)
Supported by the WCU (World Class University) program through the National Research Foundation of Korea funded by the Ministry of Education, Science, and Technology (R31-10069).

UniPrimer reviews

star_border star_border star_border star_border star_border
star star star star star

Be the first to review UniPrimer