UTR Designer statistics

To access cutting-edge analytics on consensus tools, life science contexts and associated fields, you will need to subscribe to our premium service.

Subscribe
info

Citations per year

Citations chart
info

Popular tool citations

chevron_left Translation efficiency prediction chevron_right
Popular tools chart
info

Tool usage distribution map

Tool usage distribution map
info

Associated diseases

Associated diseases

UTR Designer specifications

Information


Unique identifier OMICS_08703
Name UTR Designer
Interface Web user interface
Restrictions to use None
Computer skills Basic
Stability Stable
Maintained Yes

Maintainer


  • person_outline Gyoo Yeol Jung <>

Publication for UTR Designer

UTR Designer in publications

 (15)
PMCID: 5948957
PMID: 29666238
DOI: 10.1073/pnas.1715806115

[…] 26 rbs-6 variants were transformed and relative rbs activity was determined as a steady-state measurement with cell-free, in vivo, and through in silico prediction, using the rbs calculator () and utr designer () models. interestingly, two variants (psjm1211 - 5′-gaggaggtattat-3′ and psjm1223 - 5′-aagggggtattat-3′) identified from the cell-free screen displayed a twofold enhanced activity […]

PMCID: 5834881
PMID: 29499707
DOI: 10.1186/s12934-018-0882-2

[…] interactions which would explain the functional divergence. in addition, estimation of the translation efficiencies based on the 13 rbs sequences using the salis calculator (fig. b) and utr designer (additional file ) resulted in similar outputs that differed significantly from the measured expression profiles, supporting the view that that the reverse engineering approach […]

PMCID: 5765039
PMID: 29323285
DOI: 10.1038/s41598-017-18846-1

[…] of the nucleotides located up- and downstream from the sd domain can clearly strongly affect translation efficiency.table 1figure 1table 2figure 2, there are two widely used online programs (utr designer (https://omictools.com/utr-designer-tool) and rbs calculator (https://www.denovodna.com/software/reverse)) that allow the translation initiation rate from a certain rbs to be predicted,. […]

PMCID: 5515457
PMID: 28719630
DOI: 10.1371/journal.pone.0181501

[…] one of the lycopene synthesis rate-limiting enzymes, in an e. coli strain expressing the λ-red system on the plasmid psim5. a strong 5′-utr (ctagttggtaaggagtctatagttg) was predicted using the utr designer program []. the same cassette was then replaced with an oligo (i.e., utr-dxs) containing a strong 5′-utr flanked by the respective homologous sequences of dxs. short ssdna (oligos) […]

PMCID: 5535158
PMID: 28677629
DOI: 10.3390/toxins9070211

[…] our findings based on ribo-seq data. we predicted tirs using three experimentally-conditioned tir calculators, of which two are based on detailed thermodynamic models (the rbs calculator [,] and the utr designer []), and a third is based on a log-linear regression of e. coli gene expression (barrick calculator []). the results from the tir calculators vary greatly due to the inherent differences […]


To access a full list of publications, you will need to upgrade to our premium service.

UTR Designer institution(s)
Pohang University of Science and Technology, Hyoja-dong, Nam-gu, Pohang, Gyeongbuk, Korea

UTR Designer reviews

star_border star_border star_border star_border star_border
star star star star star

Be the first to review UTR Designer