UTR Designer statistics

info info

Citations per year

Number of citations per year for the bioinformatics software tool UTR Designer
info

Tool usage distribution map

This map represents all the scientific publications referring to UTR Designer per scientific context
info info

Associated diseases

info

Popular tool citations

chevron_left Translation efficiency prediction chevron_right
Want to access the full stats & trends on this tool?

Protocols

UTR Designer specifications

Information


Unique identifier OMICS_08703
Name UTR Designer
Interface Web user interface
Restrictions to use None
Computer skills Basic
Stability Stable
Maintained Yes

Maintainer


  • person_outline Gyoo Yeol Jung

Publication for UTR Designer

UTR Designer citations

 (16)
call_split

Rapid acquisition and model based analysis of cell free transcription–translation reactions from nonmodel bacteria

2018
Proc Natl Acad Sci U S A
PMCID: 5948957
PMID: 29666238
DOI: 10.1073/pnas.1715806115
call_split See protocol

[…] re 26 RBS-6 variants were transformed and relative RBS activity was determined as a steady-state measurement with cell-free, in vivo, and through in silico prediction, using the RBS Calculator () and UTR Designer () models. Interestingly, two variants (pSJM1211 - 5′-GAGGAGGTATTAT-3′ and pSJM1223 - 5′-AAGGGGGTATTAT-3′) identified from the cell-free screen displayed a twofold enhanced activity in vi […]

library_books

Translation efficiency of heterologous proteins is significantly affected by the genetic context of RBS sequences in engineered cyanobacterium Synechocystis sp. PCC 6803

2018
Microb Cell Fact
PMCID: 5834881
PMID: 29499707
DOI: 10.1186/s12934-018-0882-2

[…] Nucleotide sequence analysis of the alternative RBSs in context with the YFP and GFP was performed using the Salis RBS calculator [] and the UTR Designer [] for the prediction of the translation initiation rate, using the − 25 to + 35 sequences of the mRNA transcripts as input (reverse engineering). The same sequences, as well as the entir […]

library_books

A set of synthetic versatile genetic control elements for the efficient expression of genes in Actinobacteria

2018
Sci Rep
PMCID: 5765039
PMID: 29323285
DOI: 10.1038/s41598-017-18846-1

[…] umming up, the sequences of the nucleotides located up- and downstream from the SD domain can clearly strongly affect translation efficiency.Figure 1Figure 2There are two widely used online programs (UTR Designer (https://omictools.com/utr-designer-tool) and RBS Calculator (https://www.denovodna.com/software/reverse)) that allow the translation initiation rate from a certain RBS to be predicted,. […]

library_books

Oligo and dsDNA mediated genome editing using a tetA dual selection system in Escherichia coli

2017
PLoS One
PMCID: 5515457
PMID: 28719630
DOI: 10.1371/journal.pone.0181501

[…] encodes one of the lycopene synthesis rate-limiting enzymes, in an E. coli strain expressing the λ-Red system on the plasmid pSIM5. A strong 5′-UTR (CTAGTTGGTAAGGAGTCTATAGTTG) was predicted using the UTR designer program []. The same cassette was then replaced with an oligo (i.e., UTR-dxs) containing a strong 5′-UTR flanked by the respective homologous sequences of dxs. Short ssDNA (oligos) transf […]

library_books

Mechanisms for Differential Protein Production in Toxin–Antitoxin Systems

2017
Toxins
PMCID: 5535158
PMID: 28677629
DOI: 10.3390/toxins9070211

[…] equence we used included the entire 5′ UTR region as determined by the transcription start site annotated in the EcoCyc database [] to the end of the TA system. The reverse engineering feature of the UTR Designer was used with the required input of −25 to +35 from the start codon for each gene []. The third method analyzed the sequence −11 to +1 from the start codon using an equation based on empi […]

library_books

A simple method to control glycolytic flux for the design of an optimal cell factory

2017
Biotechnol Biofuels
PMCID: 5480111
PMID: 28649279
DOI: 10.1186/s13068-017-0847-4

[…] gene, exhibiting recessive sensitivity to streptomycin in a merodiploid (JHL110). Finally, oligo recombination using [ptsG_UTR(1 to 5)_oligo] that had distinctly redesigned 5′-UTR sequences based on UTR Designer (http://sbi.postech.ac.kr/utr_designer) [] resulted in the ptsG UTR variants, UTR1, 2, 3, 4, and 5, without gaps (Fig. ). The other strains were constructed in the same manner. […]


Want to access the full list of citations?
UTR Designer institution(s)
Pohang University of Science and Technology, Hyoja-dong, Nam-gu, Pohang, Gyeongbuk, Korea

UTR Designer reviews

star_border star_border star_border star_border star_border
star star star star star

Be the first to review UTR Designer