V-pipe statistics

To access cutting-edge analytics on consensus tools, life science contexts and associated fields, you will need to subscribe to our premium service.

Subscribe
info

Citations per year

Citations chart
info

Popular tool citations

chevron_left Genome assembly SNV detection Haplotype assembly Bioinformatics workflows Read quality control chevron_right
Popular tools chart
info

Tool usage distribution map

Tool usage distribution map
info

Associated diseases

Associated diseases

Protocols

To access compelling stats and trends, optimize your time and resources and pinpoint new correlations, you will need to subscribe to our premium service.

Subscribe

V-pipe specifications

Information


Unique identifier OMICS_22644
Name V-pipe
Software type Framework/Library, Pipeline/Workflow
Interface Command line interface
Restrictions to use None
Operating system Unix/Linux, Mac OS
Programming languages Python, Shell (Bash)
License Apache License version 2.0
Computer skills Advanced
Stability Stable
Maintained Yes

Download


Versioning


Add your version

Documentation


Maintainer


  • person_outline V-pipe team <>

Additional information


Mailing list : https://sympa.ethz.ch/sympa/info/v-pipe-users

V-pipe in pipeline

2009
PMCID: 2954213
PMID: 20944219
DOI: 10.1107/S1744309109018168

[…] 3′-ends. the expression vector, pspeedet, which encodes an amino-terminal tobacco etch virus (tev) protease-cleavable expression and purification tag (mgsdkihhhhhhen­lyfqg), was pcr-amplified with v-pipe (vector) primers (forward primer, 5′-taacgcgacttaattaactcgtttaaacggtctccagc-3′; reverse primer, 5′-gccctggaagtacaggttttcgtgatgatgatgatgatg-3′). v-pipe and i-pipe pcr products were mixed […]


To access a full list of citations, you will need to upgrade to our premium service.

V-pipe in publications

 (25)
PMCID: 5404680
PMID: 28438207
DOI: 10.1186/s12934-017-0681-1

[…] was pcr amplified from pkobeg plasmid [] and was cloned into pcas9 plasmid using the polymerase incomplete primer extension (pipe) cloning method []. briefly, the vector pcas9 was linearized by v-pipe pcr amplification with primers pipe1 pcas9-f/pipe1 pcas9-r. the insert, the λ red cassette, was i-pipe pcr amplified with primers redf/redr, which contain 5′ sequences complementary to the two […]

PMCID: 4850288
PMID: 26940874
DOI: 10.1074/jbc.M115.706143

[…] (shown below). the expression vector, pspeedet, which encodes an amino-terminal tobacco etch virus protease-cleavable expression and purification tag (mgsdkihhhhhhenlyfq/g), was pcr amplified with v-pipe (vector) primers. v-pipe and i-pipe pcr products were mixed to anneal the amplified dna fragments together. escherichia coli genehogs (invitrogen) competent cells were transformed […]

PMCID: 4600125
PMID: 26374125
DOI: 10.1128/mBio.02327-14

[…] 3′ ends. the expression vector, pspeedet, which encodes an amino-terminal tobacco etch virus (tev) protease-cleavable expression and purification tag (mgsdkihhhhhhenlyfq/g), was pcr amplified with v-pipe (vector) primers (forward primer, 5′ taacgcgacttaattaactcgtttaaacggtctccagc 3′, and reverse primer, 5′ gccctggaagtacaggttttcgtgatgatgatgatgatg 3′). v-pipe and i-pipe pcr products were mixed […]

PMCID: 4380455
PMID: 25826626
DOI: 10.1371/journal.pone.0122512

[…] 3' ends. the expression vector, pspeedet, which encodes an amino-terminal tobacco etch virus (tev) protease-cleavable expression and purification tag (mgsdkihhhhhhenlyfq/g), was pcr amplified with v-pipe (vector) primers (forward primer: 5’-taacgcgacttaattaactcgtttaaacggtctccagc-3’, reverse primer: 5’-gccctggaagtacaggttttcgtgatgatgatgatgatg-3’). v-pipe and i-pipe pcr products were mixed […]

PMCID: 3439487
PMID: 22984442
DOI: 10.1371/journal.pone.0043761

[…] construct. the expression vector, pspeedet, which encodes an amino-terminal tobacco etch virus (tev) protease-cleavable expression and purification tag (mgsdkihhhhhhenlyfq/g), was pcr amplified with v-pipe (vector) primers (forward primer: 5′-taacgcgacttaattaactcgtttaaacggtctccagc-3′, reverse primer: 5′-gccctggaagtacaggttttcgtgatgatgatgatgatg-3′). v-pipe and i-pipe pcr products were mixed […]


To access a full list of publications, you will need to upgrade to our premium service.

V-pipe institution(s)
Department of Biosystems Science and Engineering, ETH Zurich, Basel, Switzerland ; Swiss Institute of Bioinformatics, Lausanne, Switzerland

V-pipe reviews

star_border star_border star_border star_border star_border
star star star star star

Be the first to review V-pipe