VarSeq protocols

View VarSeq computational protocol

VarSeq statistics

To access cutting-edge analytics on consensus tools, life science contexts and associated fields, you will need to subscribe to our premium service.

Subscribe
info

Citations per year

Citations chart
info

Popular tool citations

chevron_left SNP detection SNP/SNV annotation Variant visualization chevron_right
Popular tools chart
info

Tool usage distribution map

Tool usage distribution map
info

Associated diseases

Associated diseases

VarSeq specifications

Information


Unique identifier OMICS_18804
Name VarSeq
Interface Web user interface
Restrictions to use License purchase required
Computer skills Basic
Stability Stable
Free trial Yes
Maintained Yes

Additional information


Access available upon request.

VarSeq in pipelines

 (2)
2018
PMCID: 5789682
PMID: 29378665
DOI: 10.1186/s13293-018-0167-9

[…] genotyper, then recalibrated and filtered using gatk variant-quality score recalibration and variant filtration tools. all high-quality variants were annotated using snp&variation suite and varseq—variant filtration and annotation software (golden helix, usa). all variants were filtered by a minor allele frequency (maf) of < 1% and intersected with the dsd gene list to identify […]

2017
PMCID: 5701303
PMID: 28652255
DOI: 10.1101/mcs.a002014

[…] scores, and cycle and context covariates. variants were called with gatk haplotypecaller to generate genome variant call format (gvcf). variant filtering and annotation was done using golden helix varseq version 1.1 software (golden helix inc.; http://goldenhelix.com/products/varseq/). the gvcf of each sequenced family member is uploaded to varseq and organized by pedigree. variants […]


To access a full list of citations, you will need to upgrade to our premium service.

VarSeq in publications

 (10)
PMCID: 5853080
PMID: 29540175
DOI: 10.1186/s12944-018-0680-1

[…] 2, targeted next-generation sequencing of genomic dna comprised all known dyslipidemia genes, including mttp (abl gene), apob (fhbl gene), pcsk9 and sar1b (chylomicron retention disease gene) [, ]. varseq software prioritized possible or likely pathogenic rare variants of using the online mendelian inheritance in man database (https://www.ncbi.nlm.nih.gov/omim/). prediction algorithms […]

PMCID: 5793776
PMID: 29092958
DOI: 10.1101/mcs.a001990

[…] protocols., raw fastq files were aligned to the human genome (hg19 version), and snps and indels were called using the bina pipeline (http://www.bina.com). for variant filtering, golden helix varseq software (http://goldenhelix.com/products/varseq/) was used., we used 5′ggcctggagaagtgtcagat3′ and 5gtctcgtacctaggcctgtc3′ for pcr amplification of the variant sequence. pcr amplification […]

PMCID: 5746122
PMID: 29296220
DOI: 10.18632/oncotarget.22445

[…] mutation was a point mutation, loh analysis was performed utilizing vcp filtered sequencing data (.vcf-files) on the predisposing mmr gene mutation regions obtained from tumor and normal samples by varseq (goldenhelix®). the ratio of variant allele (alt) to reference allele (ref) reads was determined in tumor (t) and matching normal (n) dna and the loh ratio calculated using the following […]

PMCID: 5701303
PMID: 28652255
DOI: 10.1101/mcs.a002014

[…] family members (, individuals with an asterisk). samples were sequenced with a mean depth of coverage of >80× (; supplemental fig. s1). variant filtering and annotations were performed using varseq software (goldenhelix inc.). we identified 87,882 variants shared in all sequenced family members (). variants were filtered based on (i) genotype quality (gq) score of >20, (ii) read depth […]

PMCID: 5665663
PMID: 28874442
DOI: 10.1194/jlr.D079301

[…] t-tests were used for all statistical comparisons against the profiles of normal controls (p < 0.05)., the bioinformatics tool cnv caller, an application within the variant annotation software varseq v1.4.3 (golden helix, bozeman, mt), was used for analysis of our existing lipidseq data set for cnv detection. varseq cnv caller requires .vcf and .bam files (generated by ngs; see above) […]


To access a full list of publications, you will need to upgrade to our premium service.

VarSeq reviews

star_border star_border star_border star_border star_border
star star star star star

Be the first to review VarSeq