ZFN-Site statistics

To access cutting-edge analytics on consensus tools, life science contexts and associated fields, you will need to subscribe to our premium service.

Subscribe
info

Citations per year

Citations chart
info

Popular tool citations

chevron_left ZFN design chevron_right
Popular tools chart
info

Tool usage distribution map

Tool usage distribution map
info

Associated diseases

Associated diseases

ZFN-Site specifications

Information


Unique identifier OMICS_04718
Name ZFN-Site
Interface Web user interface
Restrictions to use None
Programming languages C, Perl
License GNU General Public License version 2.0
Computer skills Basic
Stability Stable
Maintained Yes

Maintainer


  • person_outline Thomas J. Cradick <>

Publication for ZFN-Site

ZFN-Site in publications

 (15)
PMCID: 5941146
PMID: 29528422
DOI: 10.1093/jrr/rry007

[…] in a homology arm-tagged targeting vector, but the efficacy of isolation of the hdr-mediated knockout clones was low, at ~1% of drug-resistant clones []. in contrast, maresca et al. inserted a zfn site located in the genome into a drug-resistant gene cassette vector without long-homology arms, and cointroduced the zfn and the targeting vector into human cultured cells to generate […]

PMCID: 5693998
PMID: 29150643
DOI: 10.1038/s41598-017-16150-6

[…] 21 reverse primer; tagccatgttcacaaaggca: intron 24 forward primer; tgggactgtgtggtgcttta, intron 24 reverse primer; agccaaagataggccattga) designed from the length of nucleotide sequences flanking the zfn site. pcr products were identified by agarose gel electrophoresis and ethidium bromide staining and the sites of mutations resolved by dna sequence analysis. attempts were made to mate a founder […]

PMCID: 5519549
PMID: 28729543
DOI: 10.1038/s41598-017-06393-8

[…] to design a procedure for site-specific gene insertion utilizing nhej activity, which is the dominant pathway of dna repair in human cell lines. maresca et al. inserted the artificial nuclease zfn site located in the genome into a drug-resistant gene cassette plasmid vector, and cointroduced the zfn and the targeting vector into human cultured cells to isolate the targeted clones with high […]

PMCID: 5247676
PMID: 28106097
DOI: 10.1038/srep40980

[…] mixture of wild-type and mutant sequences, suggesting that all founder mice were mosaic. all eight genomic dnas were confirmed to contain deletions of 1-nucleotide to 48-nucleotides at the expected zfn site. we chose a founder mouse with a 19-nucleotide deletion () to breed with wild-type fvb mice for establishing a germline-transmitted mutant mouse line and further characterization. […]

PMCID: 4786920
PMID: 26689265
DOI: 10.1038/mt.2015.223

[…] high-confidence somatic variants were analyzed further to generate the final list of candidate indels for experimental validation., putative off-target sites in hg19 were identified in silico using zfn-site. the left and right zfn half-sites were atcctgtcccta and accccacagtgg, respectively. the allowed spacing was 5 or 6 bp and the maximum number of mismatches per half-site was set to 2. […]


To access a full list of publications, you will need to upgrade to our premium service.

ZFN-Site institution(s)
University of Iowa School of Medicine, Department of Internal Medicine, Iowa City, IA, USA

ZFN-Site reviews

star_border star_border star_border star_border star_border
star star star star star

Be the first to review ZFN-Site