ZiFiT statistics

Tool stats & trends

Looking to identify usage trends or leading experts?

Protocols

ZiFiT specifications

Information


Unique identifier OMICS_04705
Name ZiFiT
Alternative name Zinc Finger Targeter
Interface Web user interface
Restrictions to use None
Input data Target region seq (single and batched)
Computer skills Basic
Stability No
Maintained No

Maintainer


This tool is not available anymore.

Publication for Zinc Finger Targeter

ZiFiT citations

 (145)
library_books

CRISPR/Cas9 mediated gene knockout of Anopheles gambiae FREP1 suppresses malaria parasite infection

2018
PLoS Pathog
PMCID: 5843335
PMID: 29518156
DOI: 10.1371/journal.ppat.1006898

[…] ng sequence for the PAMs (NGG) was initially undertaken, with N representing any nucleotide. We checked candidate gRNA sequences for potential off-target binding using the following web tools: http://zifit.partners.org/ZiFiT/, http://crispr.mit.edu/, http://www.rgenome.net/cas-designer/, and http://chopchop.cbu.uib.no/, and retained three 20-nucleotide specific target sequences that were followed […]

library_books

Insights into the ubiquitin proteasome system of human embryonic stem cells

2018
Sci Rep
PMCID: 5840266
PMID: 29511261
DOI: 10.1038/s41598-018-22384-9

[…] and R: CAGCACTGCTTGACAGTGCTGGG; Guide B, targeting the fifth exon, F: CCGTCCAGTCAGCCACCACCACC, and R: CAGCCCTGCGACTCAAGCAGAGG), were generated using the Zinc Finger Consortium online resource (http://zifit.partners.org/ZiFiT/). Guide-carrying plasmid were designed as previously described in refs, using Cas9-puromycine selection plasmid (pX335-U6-Chimeric_BB-CBh-hSpCas9n(D10A) was a gift from Feng […]

library_books

N 6 Methyladenosine modification of lincRNA 1281 is critically required for mESC differentiation potential

2018
Nucleic Acids Res
PMCID: 5934679
PMID: 29529255
DOI: 10.1093/nar/gky130

[…] Plasmids for guide RNA (designed with the CRISPR design tool Zinc Finger Targeter (,)), a Cas9 expression plasmid, and a donor plasmid containing the PGK-Puro insert were cotransfected into mESCs using an electroporation method. Cells were plated at low density […]

library_books

Allele specific long distance regulation dictates IL 32 isoform switching and mediates susceptibility to HIV 1

2018
Sci Adv
PMCID: 5833994
PMID: 29507875
DOI: 10.1126/sciadv.1701729

[…] -puro U6 sgRNA BfuAI large stuffer, was cloned into pBluescript to yield pBS-puro U6 sgRNA BfuAI large stuffer. Oligos for guide RNAs targeting the rs4349147 containing DHS region were designed using ZiFiT (Zinc Finger Targeter) (http://zifit.partners.org/ZiFiT/CSquare9Nuclease.aspx) () and cloned into the BfuAI sites of pBS-puro U6 sgRNA BfuAI large stuffer. Sequences for the oligos used are avai […]

library_books

Mutation in the Zebrafish cct2 Gene Leads to Abnormalities of Cell Cycle and Cell Death in the Retina: A Model of CCT2 Related Leber Congenital Amaurosis

2018
PMCID: 5815422
PMID: 29450543
DOI: 10.1167/iovs.17-22919

[…] GAGTTTTCTGGAGTCTCCATGGTT-3′ and 5′-TACCATCATCAGGGCTTTGGCGAA-3′. Guide RNA (gRNA) for the targeted region of cct2 was designed using OPTIMIZED-CRISPR (in the public domain, http://crispr.mit.edu/) and ZiFiT Targeter (in the public domain, http://zifit.partners.org/ZiFiT/). Because of the polymorphism 4 bp upstream of the targeted codon (corresponds to position 400 in the amino acid sequence), two g […]

library_books

SWELL1 is a glucose sensor regulating β cell excitability and systemic glycaemia

2018
Nat Commun
PMCID: 5785485
PMID: 29371604
DOI: 10.1038/s41467-017-02664-0

[…] Swell1fl/fl mice were generated as previously described. Briefly, Swell1 intronic sequences were obtained from Ensembl Transcript ID ENSMUST00000139454. All CRISPR/Cas9 sites were identified using ZiFit Targeter Version 4.2 (http://zifit.partners.org/ZiFiT/). Pairs of oligonucleotides corresponding to the chosen CRISPR-Cas9 target sites were designed, synthesized, annealed, and cloned into the […]

Citations

Looking to check out a full list of citations?

ZiFiT institution(s)
Molecular Pathology Unit, Center for Cancer Research, and Center for Computational and Integrative Biology, Massachusetts General Hospital, Charlestown, MA, USA; Department of Pathology, Harvard Medical School, Boston, MA, USA; Biological and Biomedical Sciences Program, Harvard Medical School, Boston, MA, USA; Department of Genetics, Development and Cell Biology, Interdepartmental Graduate Program in Bioinformatics and Computational Biology, Iowa State University, Ames, IA, USA; Department of Genetics, Cell Biology & Development, Center for Genome Engineering, University of Minnesota, Minneapolis, MN, USA
ZiFiT funding source(s)
Supported by National Institutes of Health [T32CA009216]; National Science Foundation Graduate Research Fellowship [2009080622]; National Science Foundation [DBI 0923827, DBI 0501678]; National Institutes of Health [R01 GM069906, R01 GM072621, R01 GM088040], the National Science Foundation [DBI 0923827] and Massachusetts General Hospital Pathology Service; and National Science Foundation [DBI 0923827].

ZiFiT reviews

star_border star_border star_border star_border star_border
star star star star star

Be the first to review ZiFiT